Incidental Mutation 'R4414:Dse'
ID328068
Institutional Source Beutler Lab
Gene Symbol Dse
Ensembl Gene ENSMUSG00000039497
Gene Namedermatan sulfate epimerase
SynonymsSart2, DS-epi1, B130024B19Rik
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location34151393-34207715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34152636 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 819 (F819L)
Ref Sequence ENSEMBL: ENSMUSP00000040074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048010] [ENSMUST00000217051]
Predicted Effect probably benign
Transcript: ENSMUST00000048010
AA Change: F819L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040074
Gene: ENSMUSG00000039497
AA Change: F819L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4962 24 353 5.2e-11 PFAM
low complexity region 558 568 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 935 952 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216774
Predicted Effect probably benign
Transcript: ENSMUST00000217051
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length with altered skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Dse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dse APN 10 34162805 missense probably damaging 1.00
IGL01828:Dse APN 10 34152776 missense probably damaging 0.97
IGL01835:Dse APN 10 34160217 splice site probably benign
IGL01942:Dse APN 10 34155993 missense probably benign 0.02
IGL02047:Dse APN 10 34162845 nonsense probably null
IGL02208:Dse APN 10 34152437 missense probably benign
IGL02306:Dse APN 10 34160134 missense probably damaging 0.96
IGL02504:Dse APN 10 34152800 missense probably benign
IGL02626:Dse APN 10 34153162 missense probably damaging 0.99
IGL02812:Dse APN 10 34183716 missense probably damaging 1.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0131:Dse UTSW 10 34153664 missense probably damaging 1.00
R1300:Dse UTSW 10 34152415 missense probably benign 0.00
R1502:Dse UTSW 10 34153218 missense probably damaging 1.00
R1619:Dse UTSW 10 34153234 missense probably damaging 1.00
R1736:Dse UTSW 10 34153149 missense probably damaging 1.00
R1857:Dse UTSW 10 34153229 missense probably benign 0.03
R1858:Dse UTSW 10 34153229 missense probably benign 0.03
R1859:Dse UTSW 10 34153229 missense probably benign 0.03
R1868:Dse UTSW 10 34153288 missense possibly damaging 0.86
R1959:Dse UTSW 10 34160206 missense probably damaging 1.00
R2082:Dse UTSW 10 34155940 missense probably damaging 1.00
R2325:Dse UTSW 10 34184047 missense probably benign 0.23
R2883:Dse UTSW 10 34152507 missense probably benign 0.34
R3436:Dse UTSW 10 34152474 missense probably benign
R3818:Dse UTSW 10 34153433 missense probably benign
R4158:Dse UTSW 10 34153334 missense probably damaging 1.00
R4159:Dse UTSW 10 34153334 missense probably damaging 1.00
R4160:Dse UTSW 10 34153334 missense probably damaging 1.00
R4229:Dse UTSW 10 34162744 missense probably damaging 1.00
R4667:Dse UTSW 10 34153012 missense probably damaging 1.00
R4669:Dse UTSW 10 34153012 missense probably damaging 1.00
R4777:Dse UTSW 10 34153588 missense possibly damaging 0.56
R5154:Dse UTSW 10 34153661 missense possibly damaging 0.83
R5573:Dse UTSW 10 34152682 missense probably benign 0.02
R5804:Dse UTSW 10 34153379 missense possibly damaging 0.84
R5844:Dse UTSW 10 34153042 missense probably damaging 0.99
R5895:Dse UTSW 10 34152605 missense probably damaging 1.00
R6290:Dse UTSW 10 34152340 missense probably benign 0.00
R6600:Dse UTSW 10 34152541 missense probably benign 0.06
R7088:Dse UTSW 10 34153889 missense probably damaging 1.00
R7254:Dse UTSW 10 34184148 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTGAAGGTGCTCTGTTG -3'
(R):5'- GAGTCCAGAACACAGCTAGC -3'

Sequencing Primer
(F):5'- GTTGTGACTTGTCACCATCCG -3'
(R):5'- CTAGCTTTAGAAAGACTGCCGAGC -3'
Posted On2015-07-07