Incidental Mutation 'R4436:Xpo7'
ID329547
Institutional Source Beutler Lab
Gene Symbol Xpo7
Ensembl Gene ENSMUSG00000022100
Gene Nameexportin 7
Synonyms4930506C02Rik, Ranbp16
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70654246-70766628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70669429 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 945 (T945M)
Ref Sequence ENSEMBL: ENSMUSP00000154350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022696] [ENSMUST00000167242] [ENSMUST00000226448] [ENSMUST00000228346]
Predicted Effect probably damaging
Transcript: ENSMUST00000022696
AA Change: T944M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022696
Gene: ENSMUSG00000022100
AA Change: T944M

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167242
AA Change: T945M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129504
Gene: ENSMUSG00000022100
AA Change: T945M

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226448
AA Change: T944M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226607
Predicted Effect probably damaging
Transcript: ENSMUST00000228346
AA Change: T945M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-16 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Xpo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Xpo7 APN 14 70671658 missense probably benign 0.32
IGL01066:Xpo7 APN 14 70701755 missense probably benign 0.01
IGL01610:Xpo7 APN 14 70703230 missense probably damaging 1.00
IGL01716:Xpo7 APN 14 70685555 missense probably damaging 1.00
IGL01885:Xpo7 APN 14 70666035 missense probably benign 0.03
IGL02647:Xpo7 APN 14 70685465 missense probably damaging 1.00
IGL03088:Xpo7 APN 14 70681262 missense probably benign 0.09
IGL03245:Xpo7 APN 14 70688294 missense probably damaging 1.00
froggie UTSW 14 70682347 missense probably damaging 1.00
PIT4687001:Xpo7 UTSW 14 70667149 missense probably benign 0.22
R0893:Xpo7 UTSW 14 70666097 splice site probably benign
R1222:Xpo7 UTSW 14 70667084 missense possibly damaging 0.55
R1474:Xpo7 UTSW 14 70699033 missense probably benign 0.00
R1509:Xpo7 UTSW 14 70678142 missense probably damaging 0.99
R1867:Xpo7 UTSW 14 70693991 missense probably damaging 1.00
R1898:Xpo7 UTSW 14 70695624 missense probably benign 0.20
R2105:Xpo7 UTSW 14 70690991 missense probably benign 0.02
R2369:Xpo7 UTSW 14 70687731 nonsense probably null
R2937:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2938:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2940:Xpo7 UTSW 14 70667136 missense probably damaging 1.00
R2940:Xpo7 UTSW 14 70667137 missense probably benign 0.38
R3001:Xpo7 UTSW 14 70692645 splice site probably benign
R4529:Xpo7 UTSW 14 70668748 missense probably damaging 1.00
R4873:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4875:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4907:Xpo7 UTSW 14 70670629 missense probably benign 0.16
R5007:Xpo7 UTSW 14 70688264 missense probably damaging 1.00
R5282:Xpo7 UTSW 14 70683731 missense probably damaging 1.00
R5346:Xpo7 UTSW 14 70683677 missense probably damaging 1.00
R5522:Xpo7 UTSW 14 70671650 nonsense probably null
R5533:Xpo7 UTSW 14 70693967 missense probably damaging 1.00
R5668:Xpo7 UTSW 14 70682846 missense possibly damaging 0.52
R6042:Xpo7 UTSW 14 70695663 missense possibly damaging 0.47
R6052:Xpo7 UTSW 14 70683719 missense possibly damaging 0.68
R6066:Xpo7 UTSW 14 70682338 missense probably null 0.99
R6085:Xpo7 UTSW 14 70696611 missense probably benign 0.38
R6180:Xpo7 UTSW 14 70682803 missense probably benign 0.14
R6291:Xpo7 UTSW 14 70704690 nonsense probably null
R6401:Xpo7 UTSW 14 70682347 missense probably damaging 1.00
R6593:Xpo7 UTSW 14 70682362 missense probably damaging 0.99
R6725:Xpo7 UTSW 14 70676813 missense probably damaging 1.00
R6938:Xpo7 UTSW 14 70666024 missense probably benign 0.00
R6996:Xpo7 UTSW 14 70669448 missense probably benign
R7020:Xpo7 UTSW 14 70666023 missense probably benign 0.00
R7053:Xpo7 UTSW 14 70684858 critical splice donor site probably null
R7061:Xpo7 UTSW 14 70671072 missense probably benign 0.04
R7095:Xpo7 UTSW 14 70704706 missense probably damaging 1.00
X0062:Xpo7 UTSW 14 70685528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACATCTGCACAGTGAGATG -3'
(R):5'- CTCCATTTTAAAATCAGGCCCTGTG -3'

Sequencing Primer
(F):5'- ACAGTGAGATGTGAGTCATTTGGC -3'
(R):5'- TAAAATCAGGCCCTGTGTATCCTCAG -3'
Posted On2015-07-21