Incidental Mutation 'R4436:Pi4ka'
ID329553
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4436 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17282382 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1885 (M1885V)
Ref Sequence ENSEMBL: ENSMUSP00000036162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000164950] [ENSMUST00000232232] [ENSMUST00000232364]
Predicted Effect probably damaging
Transcript: ENSMUST00000036161
AA Change: M1885V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: M1885V

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148110
Predicted Effect probably damaging
Transcript: ENSMUST00000154364
AA Change: M1885V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: M1885V

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162522
Predicted Effect probably benign
Transcript: ENSMUST00000164950
SMART Domains Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
coiled coil region 5 112 N/A INTRINSIC
Pfam:TMEM191C 182 302 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232092
Predicted Effect probably benign
Transcript: ENSMUST00000232167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232220
Predicted Effect probably damaging
Transcript: ENSMUST00000232232
AA Change: M1885V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000232364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232636
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense not run
R7552:Pi4ka UTSW 16 17291216 missense not run
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATGGGCTGCCATTCTAGTTC -3'
(R):5'- TCTCTCAGTGAAAGACAGAAGCC -3'

Sequencing Primer
(F):5'- GTCTACAGTAGTGTAACATCGAGGCC -3'
(R):5'- GAAGCCTAGAACCCCAGGG -3'
Posted On2015-07-21