Incidental Mutation 'R4582:Naglu'
ID343746
Institutional Source Beutler Lab
Gene Symbol Naglu
Ensembl Gene ENSMUSG00000001751
Gene Namealpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Synonyms
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101070012-101077672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101071929 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 187 (I187F)
Ref Sequence ENSEMBL: ENSMUSP00000001802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001802]
Predicted Effect probably damaging
Transcript: ENSMUST00000001802
AA Change: I187F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001802
Gene: ENSMUSG00000001751
AA Change: I187F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:NAGLU_N 28 114 4.8e-24 PFAM
Pfam:NAGLU 128 463 8.2e-150 PFAM
Pfam:NAGLU_C 471 731 4.5e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140735
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that degrades heparan sulfate by hydrolysis of terminal N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides. Defects in this gene are the cause of mucopolysaccharidosis type IIIB (MPS-IIIB), also known as Sanfilippo syndrome B. This disease is characterized by the lysosomal accumulation and urinary excretion of heparan sulfate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced open field activity, massive accumulation of heparan sulfate in kidney and liver, elevated gangliosides in brain, and presence of vacuoles in macrophages, epithelial cells, and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Naglu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Naglu APN 11 101076952 missense possibly damaging 0.84
IGL01025:Naglu APN 11 101073947 missense probably benign 0.01
IGL01775:Naglu APN 11 101074095 missense probably damaging 1.00
tulane UTSW 11 101070332 missense probably benign 0.01
R0044:Naglu UTSW 11 101071217 missense probably damaging 0.99
R0281:Naglu UTSW 11 101074027 missense probably damaging 0.99
R0395:Naglu UTSW 11 101074107 unclassified probably benign
R1624:Naglu UTSW 11 101076525 missense probably damaging 1.00
R1739:Naglu UTSW 11 101076403 missense possibly damaging 0.88
R2092:Naglu UTSW 11 101076720 missense possibly damaging 0.94
R4118:Naglu UTSW 11 101074082 missense probably benign 0.39
R4792:Naglu UTSW 11 101071106 missense probably damaging 1.00
R4834:Naglu UTSW 11 101076988 missense probably benign
R5232:Naglu UTSW 11 101070150 missense probably benign 0.02
R5387:Naglu UTSW 11 101076724 missense probably damaging 1.00
R6463:Naglu UTSW 11 101077351 unclassified probably null
R6483:Naglu UTSW 11 101071181 missense probably damaging 1.00
R7141:Naglu UTSW 11 101072230 missense probably benign 0.10
R7187:Naglu UTSW 11 101070332 missense probably benign 0.01
R7232:Naglu UTSW 11 101076426 missense probably damaging 1.00
R7478:Naglu UTSW 11 101071899 missense probably damaging 1.00
X0023:Naglu UTSW 11 101072014 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGCCTCTTTGTGTCCCAG -3'
(R):5'- TAGCTAAGCACCCATCCCTG -3'

Sequencing Primer
(F):5'- ACAGACATGGAGCTGTTTCC -3'
(R):5'- TGGCTCTGTGAACACTCAG -3'
Posted On2015-09-24