Incidental Mutation 'R0365:Mtor'
ID36331
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 038571-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0365 (G1)
Quality Score140
Status Not validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148486050 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1188 (Y1188F)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect probably benign
Transcript: ENSMUST00000103221
AA Change: Y1188F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: Y1188F

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,692 M173K probably benign Het
Abcb1b T A 5: 8,806,009 F39Y probably damaging Het
Acbd3 A G 1: 180,738,612 Y290C probably damaging Het
Alg12 A C 15: 88,816,149 I28R possibly damaging Het
Amer2 A T 14: 60,379,535 D393V probably damaging Het
Anxa5 A T 3: 36,457,469 V153D probably damaging Het
Arl5a T C 2: 52,416,129 M64V probably benign Het
Armc4 T A 18: 7,217,800 H638L probably benign Het
Astn1 T C 1: 158,688,548 L1236P probably damaging Het
Atg2a T C 19: 6,247,683 S424P possibly damaging Het
AW551984 A T 9: 39,599,321 S239R probably benign Het
Baz1b T C 5: 135,240,131 V1278A probably benign Het
Cbfa2t3 G T 8: 122,635,060 L408I probably benign Het
Cdc27 A T 11: 104,528,424 N227K possibly damaging Het
Cdh23 T A 10: 60,379,315 N1412I probably damaging Het
Cdh7 A T 1: 110,108,756 Q555H probably damaging Het
Cdhr2 T C 13: 54,718,292 S302P probably benign Het
Cep350 C A 1: 155,906,571 E1563D probably benign Het
Cfap221 T A 1: 119,985,023 E107V probably benign Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Coro6 A T 11: 77,464,090 I60F probably benign Het
Dock10 G T 1: 80,595,683 N245K probably damaging Het
Epb41l2 T A 10: 25,469,221 N286K probably damaging Het
Fam83g G T 11: 61,703,109 E490* probably null Het
Gm13088 G T 4: 143,655,501 Y208* probably null Het
Gnb1l T C 16: 18,552,461 I234T possibly damaging Het
Gtf3a T A 5: 146,948,937 W53R probably damaging Het
Ikzf4 T C 10: 128,634,407 I415V probably benign Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Il17ra G A 6: 120,478,449 V340M probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kif24 A T 4: 41,428,731 H76Q probably benign Het
Klhl25 T C 7: 75,866,516 L390P probably damaging Het
Klhl26 T C 8: 70,451,829 D443G probably damaging Het
Lama3 A T 18: 12,507,007 R86S probably damaging Het
Lrrc24 G A 15: 76,715,784 A385V probably benign Het
Maea C T 5: 33,360,443 A109V probably benign Het
Nccrp1 T C 7: 28,544,552 D202G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Nup155 C T 15: 8,131,543 R571W probably damaging Het
Nup160 T A 2: 90,708,844 M789K probably benign Het
Olfr262 A G 19: 12,241,076 F195S probably benign Het
Olfr469 A T 7: 107,822,917 L184* probably null Het
Olfr926 A T 9: 38,877,185 H3L probably benign Het
Pgpep1 G T 8: 70,652,524 probably null Het
Pkd1l2 C T 8: 117,021,850 V1861M probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plin4 G T 17: 56,104,667 T788K possibly damaging Het
Ppp3r2 T C 4: 49,681,902 D16G possibly damaging Het
Prdm16 A T 4: 154,342,056 I424N probably damaging Het
Psen2 T A 1: 180,228,845 I396F probably damaging Het
Psip1 C T 4: 83,485,712 probably null Het
Ptprd G A 4: 76,136,846 T215I probably damaging Het
Rec114 A G 9: 58,741,539 S2P probably benign Het
Rexo1 A G 10: 80,542,576 I1181T probably damaging Het
Rfx7 T C 9: 72,619,836 M1436T probably benign Het
Rnf213 T A 11: 119,426,111 V1020E possibly damaging Het
Rorc G A 3: 94,388,762 G83S probably damaging Het
Ryr2 T G 13: 11,668,839 Q3113P possibly damaging Het
Shank1 T C 7: 44,353,977 S1698P possibly damaging Het
Slc2a2 T C 3: 28,708,679 probably null Het
Slc5a9 A T 4: 111,891,836 Y98* probably null Het
Smc6 T C 12: 11,283,174 probably null Het
Sptb G T 12: 76,600,383 F1959L probably benign Het
Srgap1 T A 10: 121,785,705 H984L possibly damaging Het
Ssc5d T A 7: 4,928,467 C224* probably null Het
St5 A T 7: 109,538,949 V753E probably damaging Het
Ston2 A T 12: 91,647,860 H591Q probably benign Het
Tbx3 C T 5: 119,675,250 A222V possibly damaging Het
Thsd7a A G 6: 12,321,887 probably null Het
Usp9y T C Y: 1,364,732 D1027G probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Zfpm2 A G 15: 40,774,066 E74G possibly damaging Het
Zwint C A 10: 72,657,295 S223* probably null Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGATGGGGAATTGGCCTGGAATTAC -3'
(R):5'- AGCTATTTAGGGCACCAATGGCAC -3'

Sequencing Primer
(F):5'- GAATTGGCCTGGAATTACATCTG -3'
(R):5'- agcttgctgcctgtttcc -3'
Posted On2013-05-09