Incidental Mutation 'R4777:Ppfia3'
ID368017
Institutional Source Beutler Lab
Gene Symbol Ppfia3
Ensembl Gene ENSMUSG00000003863
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms
MMRRC Submission 041992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45339122-45367019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45341157 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1066 (G1066V)
Ref Sequence ENSEMBL: ENSMUSP00000148200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000211067] [ENSMUST00000211327]
Predicted Effect probably damaging
Transcript: ENSMUST00000003961
AA Change: G1066V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863
AA Change: G1066V

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085351
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107779
AA Change: G1066V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103408
Gene: ENSMUSG00000003863
AA Change: G1066V

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127948
AA Change: G2W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131154
AA Change: W1254C
Predicted Effect probably damaging
Transcript: ENSMUST00000137578
AA Change: G906V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118183
Gene: ENSMUSG00000003863
AA Change: G906V

DomainStartEndE-ValueType
coiled coil region 16 275 N/A INTRINSIC
coiled coil region 297 349 N/A INTRINSIC
low complexity region 383 399 N/A INTRINSIC
coiled coil region 446 491 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
low complexity region 556 568 N/A INTRINSIC
SAM 684 753 1.46e-10 SMART
SAM 790 857 8.22e-5 SMART
SAM 878 950 3.58e-5 SMART
low complexity region 996 1009 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210248
AA Change: G906V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210844
Predicted Effect probably damaging
Transcript: ENSMUST00000211067
AA Change: G1066V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211098
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. Liprin family protein has been shown to localize phosphatase LAR to cell focal adhesions and may be involved in the molecular organization of presynaptic active zones. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Ppfia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ppfia3 APN 7 45360057 splice site probably null
IGL02086:Ppfia3 APN 7 45340572
IGL02160:Ppfia3 APN 7 45360051 splice site probably benign
IGL02373:Ppfia3 APN 7 45358849 missense probably damaging 0.98
IGL02417:Ppfia3 APN 7 45341717 missense probably damaging 0.98
IGL02501:Ppfia3 APN 7 45354938 splice site probably benign
IGL02638:Ppfia3 APN 7 45356668 missense probably damaging 1.00
IGL03084:Ppfia3 APN 7 45340227 missense probably benign 0.00
R0207:Ppfia3 UTSW 7 45348534 missense probably damaging 1.00
R0962:Ppfia3 UTSW 7 45347722 splice site probably benign
R1086:Ppfia3 UTSW 7 45361758 missense probably damaging 1.00
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1566:Ppfia3 UTSW 7 45340688 missense probably damaging 1.00
R1677:Ppfia3 UTSW 7 45356666 missense probably benign 0.03
R1876:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.75
R2219:Ppfia3 UTSW 7 45354890 nonsense probably null
R2336:Ppfia3 UTSW 7 45356697 splice site probably null
R2843:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2844:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2846:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R4669:Ppfia3 UTSW 7 45352093 missense probably damaging 1.00
R4787:Ppfia3 UTSW 7 45340626 missense possibly damaging 0.89
R4994:Ppfia3 UTSW 7 45341118 missense probably damaging 1.00
R5042:Ppfia3 UTSW 7 45342341 missense probably damaging 1.00
R5821:Ppfia3 UTSW 7 45353616 missense probably damaging 0.96
R6116:Ppfia3 UTSW 7 45354703 missense probably damaging 1.00
R6515:Ppfia3 UTSW 7 45340233 missense possibly damaging 0.94
R6868:Ppfia3 UTSW 7 45353612 missense probably damaging 1.00
R6920:Ppfia3 UTSW 7 45358807 missense possibly damaging 0.46
R6935:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.47
R6978:Ppfia3 UTSW 7 45346848 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTTGCCGAGCCTGGAAAAG -3'
(R):5'- CCTAGTTGGCCAGAAGATGAG -3'

Sequencing Primer
(F):5'- TTGCCGAGCCTGGAAAAGAAAAG -3'
(R):5'- CCAGCATAGAGATTTAGCTAGGC -3'
Posted On2015-12-29