Incidental Mutation 'R4777:Plk2'
ID368049
Institutional Source Beutler Lab
Gene Symbol Plk2
Ensembl Gene ENSMUSG00000021701
Gene Namepolo like kinase 2
SynonymsSnk
MMRRC Submission 041992-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location110395046-110400844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110397773 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 296 (M296L)
Ref Sequence ENSEMBL: ENSMUSP00000022212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022212]
Predicted Effect probably benign
Transcript: ENSMUST00000022212
AA Change: M296L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022212
Gene: ENSMUSG00000021701
AA Change: M296L

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
S_TKc 79 331 7.08e-97 SMART
Blast:STYKc 335 383 9e-7 BLAST
low complexity region 448 464 N/A INTRINSIC
Pfam:POLO_box 508 569 2.5e-19 PFAM
Pfam:POLO_box 604 673 1.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225340
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the polo family of serine/threonine protein kinases that have a role in normal cell division. This gene is most abundantly expressed in testis, spleen and fetal tissues, and its expression is inducible by serum, suggesting that it may also play an important role in cells undergoing rapid cell division. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Inactivation of this gene results in impaired embryonic growth and placental defects due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Plk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Plk2 APN 13 110398764 missense probably benign 0.18
IGL00586:Plk2 APN 13 110396378 missense possibly damaging 0.61
IGL00798:Plk2 APN 13 110398034 missense probably benign 0.00
IGL01450:Plk2 APN 13 110396324 missense probably damaging 1.00
IGL01722:Plk2 APN 13 110399442 missense probably benign 0.00
IGL01937:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01945:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01993:Plk2 APN 13 110399197 missense probably damaging 1.00
IGL02231:Plk2 APN 13 110400069 missense probably benign 0.01
IGL03059:Plk2 APN 13 110399134 missense probably benign 0.42
Mite UTSW 13 110396036 nonsense
R0189:Plk2 UTSW 13 110399463 missense probably damaging 1.00
R0324:Plk2 UTSW 13 110397708 missense probably benign 0.08
R1108:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1422:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1513:Plk2 UTSW 13 110400088 missense probably benign 0.45
R2987:Plk2 UTSW 13 110397709 missense probably benign 0.03
R4050:Plk2 UTSW 13 110399866 missense probably damaging 1.00
R4211:Plk2 UTSW 13 110396337 missense probably damaging 0.98
R4278:Plk2 UTSW 13 110396103 missense probably benign 0.15
R5121:Plk2 UTSW 13 110399424 missense probably benign 0.01
R5677:Plk2 UTSW 13 110399057 missense possibly damaging 0.83
R6240:Plk2 UTSW 13 110399474 missense probably damaging 1.00
R6240:Plk2 UTSW 13 110400034 missense probably damaging 1.00
R6436:Plk2 UTSW 13 110396036 nonsense probably null
R6596:Plk2 UTSW 13 110397762 missense probably benign 0.37
R6776:Plk2 UTSW 13 110399791 missense probably benign
R6938:Plk2 UTSW 13 110396680 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGACATCTGGGCCTTAGG -3'
(R):5'- CTGTGGAACCAGAAGAGACC -3'

Sequencing Primer
(F):5'- GGCTGTGTAATGTAAGTAAATGCAC -3'
(R):5'- CTGTGGAACCAGAAGAGACCATCAG -3'
Posted On2015-12-29