Incidental Mutation 'R4810:Col11a2'
ID371039
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
MMRRC Submission 042429-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R4810 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34057112 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 470 (S470L)
Ref Sequence ENSEMBL: ENSMUSP00000115026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000131134] [ENSMUST00000143354]
Predicted Effect probably damaging
Transcript: ENSMUST00000087497
AA Change: S778L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: S778L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114252
AA Change: S783L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: S783L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114255
AA Change: S817L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: S817L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131134
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137374
Predicted Effect probably damaging
Transcript: ENSMUST00000143354
AA Change: S470L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: S470L

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173749
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,630 D190G probably damaging Het
2700049A03Rik T C 12: 71,189,442 V1189A possibly damaging Het
5330417C22Rik T A 3: 108,470,011 probably benign Het
A3galt2 T C 4: 128,755,563 probably null Het
Abca12 T C 1: 71,303,612 D903G probably benign Het
Abcc12 T C 8: 86,560,842 M125V probably damaging Het
Adad1 A G 3: 37,092,034 N517S probably damaging Het
Ankrd44 A G 1: 54,735,143 probably benign Het
Armc7 A G 11: 115,488,961 I162V probably benign Het
Art3 T A 5: 92,414,249 V343D possibly damaging Het
Bcl9l A G 9: 44,508,353 T1106A probably damaging Het
Ccdc141 T C 2: 77,045,755 N644D possibly damaging Het
Ccdc154 T C 17: 25,163,498 L98S probably damaging Het
Ccne1 A G 7: 38,099,593 W237R probably damaging Het
Cd33 T C 7: 43,532,710 I104V probably damaging Het
Ceacam1 A T 7: 25,474,520 *237K probably null Het
Ces1e T A 8: 93,208,631 I398F probably benign Het
Cfap44 T C 16: 44,451,535 I1217T probably damaging Het
Clns1a T C 7: 97,714,017 S199P probably benign Het
Cntn4 C A 6: 106,655,611 T532K probably benign Het
Cst10 A T 2: 149,405,543 R60* probably null Het
Cxcr6 A T 9: 123,810,162 D83V probably damaging Het
Dis3l2 T C 1: 87,047,574 V774A probably damaging Het
Dusp15 A G 2: 152,945,454 L79P probably damaging Het
Eml6 A T 11: 29,755,011 V1511E possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam227b A G 2: 125,987,939 F450L probably benign Het
Fam91a1 T A 15: 58,434,740 L452Q probably damaging Het
Fbxo44 T C 4: 148,156,446 Y199C probably damaging Het
Fgd3 A G 13: 49,289,650 S149P probably benign Het
Gabra4 T C 5: 71,623,982 E362G probably damaging Het
Galnt14 T C 17: 73,512,121 I325V probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10088 G T 16: 19,028,331 noncoding transcript Het
Grik5 T C 7: 25,015,497 N691D probably damaging Het
Grm1 C G 10: 10,782,694 D351H probably damaging Het
Grm8 T C 6: 27,761,296 S310G possibly damaging Het
Gtf2h2 A G 13: 100,481,002 probably null Het
Hhex G T 19: 37,439,655 L49F probably damaging Het
Hkdc1 T A 10: 62,411,525 R159S probably benign Het
Iqcm A G 8: 75,888,653 Y454C probably damaging Het
Kcnh8 G A 17: 52,905,220 probably null Het
Larp4b A G 13: 9,158,591 T427A probably benign Het
Mtmr3 A T 11: 4,498,046 N297K probably benign Het
Nek8 G A 11: 78,167,803 T557I probably benign Het
Nlrp9c A C 7: 26,378,177 probably null Het
Nmrk1 T A 19: 18,639,909 D48E probably benign Het
Npepps G A 11: 97,240,933 T365I probably damaging Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr25 A G 9: 38,330,394 E269G probably benign Het
Olfr907 C A 9: 38,499,324 Y218* probably null Het
Otud7b C T 3: 96,136,607 A23V probably damaging Het
Pcdhga9 G A 18: 37,738,548 A477T possibly damaging Het
Plekha7 A T 7: 116,144,938 I663N probably damaging Het
Polk A T 13: 96,483,495 S732R possibly damaging Het
Ppfia2 A G 10: 106,915,690 I1166V probably benign Het
Ppp2r5a C T 1: 191,356,392 probably benign Het
Prkaa2 T C 4: 105,039,814 K401E probably damaging Het
Ptpn23 A G 9: 110,389,136 Y611H possibly damaging Het
Rab31 C T 17: 65,722,003 probably null Het
Rad51ap2 T A 12: 11,457,405 C443S probably damaging Het
Ralgapa1 A G 12: 55,794,993 probably null Het
Rev3l T C 10: 39,823,725 L1406P probably benign Het
Rnaset2b T A 17: 6,991,768 D48E probably benign Het
Rnf13 G T 3: 57,796,272 M105I probably damaging Het
Rnf150 T C 8: 82,990,362 V166A possibly damaging Het
Rps6kc1 C A 1: 190,808,963 R381L probably damaging Het
Rspo2 C T 15: 43,169,820 R2H probably benign Het
Sept8 A G 11: 53,534,589 D103G probably damaging Het
Sirt4 A G 5: 115,480,449 W189R probably damaging Het
Slco6d1 T C 1: 98,423,254 V110A possibly damaging Het
Sncaip C A 18: 52,907,199 Q822K possibly damaging Het
Spg11 A C 2: 122,059,796 F2070V probably damaging Het
Sptb A T 12: 76,623,197 Y452* probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tead1 C A 7: 112,841,866 probably null Het
Tmem156 G T 5: 65,091,447 probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem260 A G 14: 48,472,473 E51G probably damaging Het
Trim36 G T 18: 46,172,469 N470K probably benign Het
Trps1 T A 15: 50,822,296 T158S probably benign Het
Ube2c A G 2: 164,772,562 *180W probably null Het
Ube2i T C 17: 25,265,147 D45G probably benign Het
Uggt2 A C 14: 119,013,521 L1188R probably damaging Het
Uroc1 T C 6: 90,363,153 I680T probably damaging Het
Vmn2r2 T A 3: 64,137,462 M88L probably damaging Het
Zfp248 G A 6: 118,429,846 R261C possibly damaging Het
Zfp418 G T 7: 7,182,847 R603L possibly damaging Het
Zmpste24 T A 4: 121,061,054 Y457F probably damaging Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCAGACTCAAGGATGTTTCTG -3'
(R):5'- AATCCATTGGGGCCTTGAGG -3'

Sequencing Primer
(F):5'- TCTGTCTACCTAGGGTCCAAGG -3'
(R):5'- GCCTTGAGGTCCAGGAAGAC -3'
Posted On2016-02-04