Incidental Mutation 'R0239:Vac14'
ID37210
Institutional Source Beutler Lab
Gene Symbol Vac14
Ensembl Gene ENSMUSG00000010936
Gene NameVac14 homolog (S. cerevisiae)
SynonymsTax1bp2, ingls, D8Wsu151e, Trx
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0239 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110618585-110720398 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 110635375 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034190] [ENSMUST00000212829] [ENSMUST00000213003]
Predicted Effect probably null
Transcript: ENSMUST00000034190
SMART Domains Protein: ENSMUSP00000034190
Gene: ENSMUSG00000010936

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 67 163 5.3e-43 PFAM
Pfam:Vac14_Fig4_bd 542 720 6.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212766
Predicted Effect probably benign
Transcript: ENSMUST00000212829
Predicted Effect probably benign
Transcript: ENSMUST00000213003
Meta Mutation Damage Score 0.55 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The content of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) in endosomal membranes changes dynamically with fission and fusion events that generate or absorb intracellular transport vesicles. VAC14 is a component of a trimolecular complex that tightly regulates the level of PtdIns(3,5)P2. Other components of this complex are the PtdIns(3,5)P2-synthesizing enzyme PIKFYVE (MIM 609414) and the PtdIns(3,5)P2 phosphatase FIG4 (MIM 609390). VAC14 functions as an activator of PIKFYVE (Sbrissa et al., 2007 [PubMed 17556371]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display early postnatal lethality with lesions in multiple regions of the brain. Mice homozygous for a hypomorphic allele exhibit postnatal lethality, spongiform degeneration, enlarged brain ventricles and coat color dilution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Vac14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Vac14 APN 8 110653607 splice site probably benign
IGL01511:Vac14 APN 8 110712798 missense possibly damaging 0.93
IGL01724:Vac14 APN 8 110618891 start codon destroyed probably null 0.85
IGL01784:Vac14 APN 8 110671168 missense probably benign 0.00
IGL02086:Vac14 APN 8 110653318 missense possibly damaging 0.74
IGL02447:Vac14 APN 8 110653628 missense probably benign 0.39
IGL02614:Vac14 APN 8 110635118 missense probably damaging 1.00
IGL03059:Vac14 APN 8 110710452 missense probably damaging 1.00
IGL03155:Vac14 APN 8 110636343 missense possibly damaging 0.90
ducky UTSW 8 110636472 splice site probably null
R0045:Vac14 UTSW 8 110636952 missense probably benign 0.00
R0045:Vac14 UTSW 8 110636952 missense probably benign 0.00
R0239:Vac14 UTSW 8 110635375 critical splice acceptor site probably null
R0718:Vac14 UTSW 8 110632477 missense probably damaging 1.00
R1696:Vac14 UTSW 8 110632447 critical splice acceptor site probably null
R1883:Vac14 UTSW 8 110711687 missense probably damaging 1.00
R1884:Vac14 UTSW 8 110711687 missense probably damaging 1.00
R1903:Vac14 UTSW 8 110682534 missense probably benign 0.04
R2764:Vac14 UTSW 8 110710455 missense probably damaging 1.00
R3000:Vac14 UTSW 8 110634317 missense probably damaging 1.00
R3498:Vac14 UTSW 8 110671090 missense probably benign
R4898:Vac14 UTSW 8 110645808 missense probably benign
R5030:Vac14 UTSW 8 110710386 missense possibly damaging 0.66
R5255:Vac14 UTSW 8 110634329 missense probably damaging 0.99
R5918:Vac14 UTSW 8 110636472 splice site probably null
R5930:Vac14 UTSW 8 110710349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATCCTGGGTGACAATGGCAAG -3'
(R):5'- GGGAAAGGCAATTCTGACCTCCAC -3'

Sequencing Primer
(F):5'- AGATTCGGAAAATGTGAGTTGTG -3'
(R):5'- GTCCTATCTTTACCTAAGGCAAAGC -3'
Posted On2013-05-09