Incidental Mutation 'R0239:Krt17'
ID37222
Institutional Source Beutler Lab
Gene Symbol Krt17
Ensembl Gene ENSMUSG00000035557
Gene Namekeratin 17
SynonymsKrt1-17, K17
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0239 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100256217-100261029 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 100260878 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 30 (R30*)
Ref Sequence ENSEMBL: ENSMUSP00000079699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017270] [ENSMUST00000080893]
Predicted Effect probably benign
Transcript: ENSMUST00000017270
SMART Domains Protein: ENSMUSP00000017270
Gene: ENSMUSG00000053654

DomainStartEndE-ValueType
low complexity region 62 84 N/A INTRINSIC
Filament 93 404 5.58e-184 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080893
AA Change: R30*
SMART Domains Protein: ENSMUSP00000079699
Gene: ENSMUSG00000035557
AA Change: R30*

DomainStartEndE-ValueType
Filament 83 394 9.36e-177 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107406
Meta Mutation Damage Score 0.6228 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.9%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the type I keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin required for the normal growth of hair follicles and may act in psoriasis as an immunopathogenic autoantigen. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display age- and strain-dependent alopecia associated with frequent absence of vibrissae, increased hair fragility, abnormal hair cycling, altered hair follicle morphology, and apoptosis in matrix cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC 3: 138,065,834 probably benign Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Krt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Krt17 APN 11 100260631 missense probably damaging 1.00
IGL02291:Krt17 APN 11 100256493 missense probably benign 0.42
IGL03392:Krt17 APN 11 100259735 missense possibly damaging 0.73
R0189:Krt17 UTSW 11 100260619 missense possibly damaging 0.95
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0239:Krt17 UTSW 11 100260878 nonsense probably null
R1448:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R1510:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R4029:Krt17 UTSW 11 100257523 missense probably damaging 1.00
R4235:Krt17 UTSW 11 100257868 missense possibly damaging 0.90
R4888:Krt17 UTSW 11 100256479 missense probably benign 0.06
R5281:Krt17 UTSW 11 100260701 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAATCTCGGATCTTCACCTCCAG -3'
(R):5'- AGCCTGTTGTAATCGCTACGCC -3'

Sequencing Primer
(F):5'- ACGCACCTTGTCCAGGTAG -3'
(R):5'- CACTGGCTGCCCTATAAAGG -3'
Posted On2013-05-09