Incidental Mutation 'R4863:Acvr1'
ID374622
Institutional Source Beutler Lab
Gene Symbol Acvr1
Ensembl Gene ENSMUSG00000026836
Gene Nameactivin A receptor, type 1
SynonymsAlk-2, ActR-I, Acvrlk2, SKR1, ALK2, Tsk7L, D330013D15Rik, Acvr, ActRIA, Alk8
MMRRC Submission 042473-MU
Accession Numbers

Genbank: NM_007394; MGI: 87911

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location58388644-58567157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58477711 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 146 (L146P)
Ref Sequence ENSEMBL: ENSMUSP00000108220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056376] [ENSMUST00000090935] [ENSMUST00000112599] [ENSMUST00000112601] [ENSMUST00000126407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056376
AA Change: L146P

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056784
Gene: ENSMUSG00000026836
AA Change: L146P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000090935
AA Change: L146P

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088453
Gene: ENSMUSG00000026836
AA Change: L146P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112599
AA Change: L146P

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108218
Gene: ENSMUSG00000026836
AA Change: L146P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 1.4e-13 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112601
AA Change: L146P

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108220
Gene: ENSMUSG00000026836
AA Change: L146P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126407
SMART Domains Protein: ENSMUSP00000120755
Gene: ENSMUSG00000026836

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 3.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145495
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth arrest and complete embryonic lethality due to gastrulation defects associated with abnormalities in primitive streak formation, embryonic epiblast morphology, and mesoderm and ectoderm development. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fcgbp A C 7: 28,086,344 D402A probably benign Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fnip1 G A 11: 54,515,556 V1160I possibly damaging Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
Myo5a A T 9: 75,217,507 K1781N probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pdpr T A 8: 111,101,951 S29T probably benign Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Plcd4 A G 1: 74,565,802 probably null Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasa4 A T 5: 136,103,911 K6* probably null Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Zp2 T G 7: 120,135,772 Y430S probably damaging Het
Other mutations in Acvr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Acvr1 APN 2 58447573 missense probably benign 0.00
IGL01392:Acvr1 APN 2 58500546 missense probably benign 0.01
IGL01526:Acvr1 APN 2 58458985 missense probably benign 0.20
IGL02524:Acvr1 APN 2 58448307 splice site probably benign
IGL02682:Acvr1 APN 2 58477811 missense probably benign 0.00
IGL02795:Acvr1 APN 2 58462952 missense probably damaging 1.00
R0084:Acvr1 UTSW 2 58458883 critical splice donor site probably null
R0452:Acvr1 UTSW 2 58500495 missense probably benign 0.13
R0746:Acvr1 UTSW 2 58500550 start codon destroyed probably null 0.01
R1484:Acvr1 UTSW 2 58479889 missense probably damaging 1.00
R1514:Acvr1 UTSW 2 58447585 nonsense probably null
R1645:Acvr1 UTSW 2 58462899 missense probably damaging 1.00
R1925:Acvr1 UTSW 2 58447649 missense probably damaging 0.99
R2435:Acvr1 UTSW 2 58479692 missense probably damaging 1.00
R2873:Acvr1 UTSW 2 58477796 nonsense probably null
R3729:Acvr1 UTSW 2 58462913 missense probably null 0.09
R3854:Acvr1 UTSW 2 58462934 missense probably damaging 1.00
R4438:Acvr1 UTSW 2 58477727 missense probably benign 0.00
R5543:Acvr1 UTSW 2 58463145 missense probably damaging 1.00
R5558:Acvr1 UTSW 2 58459017 missense probably damaging 1.00
R5618:Acvr1 UTSW 2 58462943 missense probably damaging 1.00
R6233:Acvr1 UTSW 2 58448399 missense probably benign 0.04
R6236:Acvr1 UTSW 2 58477666 missense probably benign 0.17
R6565:Acvr1 UTSW 2 58479757 missense probably damaging 1.00
R6912:Acvr1 UTSW 2 58447573 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGTCTGCATAGTCATTGTTGGC -3'
(R):5'- TCGGGATCAGGAGCCATTAC -3'

Sequencing Primer
(F):5'- GTTGGCTTTGCACATTCAAAAC -3'
(R):5'- CAGGAGCCATTACCTAAGATATTGG -3'
Posted On2016-03-17