Incidental Mutation 'R4863:Rasa4'
ID374641
Institutional Source Beutler Lab
Gene Symbol Rasa4
Ensembl Gene ENSMUSG00000004952
Gene NameRAS p21 protein activator 4
Synonyms
MMRRC Submission 042473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136083916-136111860 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 136103911 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 6 (K6*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042135] [ENSMUST00000100570]
Predicted Effect probably null
Transcript: ENSMUST00000042135
AA Change: K578*
SMART Domains Protein: ENSMUSP00000037869
Gene: ENSMUSG00000004952
AA Change: K578*

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 604 3.47e-139 SMART
PH 566 674 1.81e-11 SMART
BTK 674 710 3.6e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100570
AA Change: K532*
SMART Domains Protein: ENSMUSP00000098136
Gene: ENSMUSG00000004952
AA Change: K532*

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 558 3.48e-89 SMART
PH 520 628 1.81e-11 SMART
BTK 628 664 3.6e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122887
AA Change: K6*
SMART Domains Protein: ENSMUSP00000118929
Gene: ENSMUSG00000004952
AA Change: K6*

DomainStartEndE-ValueType
PH 6 103 1.36e-6 SMART
BTK 103 141 5.56e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140972
Predicted Effect probably benign
Transcript: ENSMUST00000145294
SMART Domains Protein: ENSMUSP00000120203
Gene: ENSMUSG00000004952

DomainStartEndE-ValueType
C2 5 68 1.88e-2 SMART
Blast:RasGAP 80 121 7e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184713
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GAP1 family of GTPase-activating proteins that suppresses the Ras/mitogen-activated protein kinase pathway in response to Ca(2+). Stimuli that increase intracellular Ca(2+) levels result in the translocation of this protein to the plasma membrane, where it activates Ras GTPase activity. Consequently, Ras is converted from the active GTP-bound state to the inactive GDP-bound state and no longer activates downstream pathways that regulate gene expression, cell growth, and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an increased sensitivity to bacterial infections which involves reduced phagocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Acvr1 A G 2: 58,477,711 L146P possibly damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fcgbp A C 7: 28,086,344 D402A probably benign Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fnip1 G A 11: 54,515,556 V1160I possibly damaging Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
Myo5a A T 9: 75,217,507 K1781N probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pdpr T A 8: 111,101,951 S29T probably benign Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Plcd4 A G 1: 74,565,802 probably null Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Zp2 T G 7: 120,135,772 Y430S probably damaging Het
Other mutations in Rasa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rasa4 APN 5 136101993 missense possibly damaging 0.95
IGL01364:Rasa4 APN 5 136095571 missense possibly damaging 0.83
IGL01835:Rasa4 APN 5 136102607 missense possibly damaging 0.95
IGL02284:Rasa4 APN 5 136101691 critical splice donor site probably null
IGL02332:Rasa4 APN 5 136095599 missense probably benign 0.02
IGL03197:Rasa4 APN 5 136102012 missense probably damaging 1.00
R0729:Rasa4 UTSW 5 136102070 splice site probably benign
R0782:Rasa4 UTSW 5 136104532 missense possibly damaging 0.94
R1124:Rasa4 UTSW 5 136105656 missense probably benign 0.07
R1673:Rasa4 UTSW 5 136104637 missense probably benign 0.12
R1902:Rasa4 UTSW 5 136091238 missense probably benign 0.01
R2357:Rasa4 UTSW 5 136091247 missense probably damaging 1.00
R2427:Rasa4 UTSW 5 136102027 missense probably benign 0.24
R2880:Rasa4 UTSW 5 136091771 missense probably damaging 1.00
R3818:Rasa4 UTSW 5 136102293 missense possibly damaging 0.65
R4647:Rasa4 UTSW 5 136101363 missense probably damaging 1.00
R4782:Rasa4 UTSW 5 136091229 nonsense probably null
R4837:Rasa4 UTSW 5 136091810 critical splice donor site probably null
R5020:Rasa4 UTSW 5 136101299 missense probably damaging 1.00
R5729:Rasa4 UTSW 5 136093162 missense probably benign
R6606:Rasa4 UTSW 5 136103947 missense probably damaging 1.00
R6750:Rasa4 UTSW 5 136100948 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACCGAGACTAAGCCTATCCG -3'
(R):5'- CCAATAAGTTATAGTCCTGTTTGCC -3'

Sequencing Primer
(F):5'- GCTGAGATTATAGCATGTGCCACC -3'
(R):5'- GACTTGAAGTCTTGGGCCTCC -3'
Posted On2016-03-17