Incidental Mutation 'R4877:Erbin'
ID375011
Institutional Source Beutler Lab
Gene Symbol Erbin
Ensembl Gene ENSMUSG00000021709
Gene NameErbb2 interacting protein
Synonyms1700028E05Rik, Erbb2ip, Erbin
MMRRC Submission 042486-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4877 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location103818787-103920514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103850838 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 405 (P405S)
Ref Sequence ENSEMBL: ENSMUSP00000140931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000053927] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022222
AA Change: P405S

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709
AA Change: P405S

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1294 1374 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000053927
AA Change: P405S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057956
Gene: ENSMUSG00000021709
AA Change: P405S

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091269
AA Change: P405S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709
AA Change: P405S

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1320 1400 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169083
AA Change: P405S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709
AA Change: P405S

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1329 1409 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188997
AA Change: P405S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709
AA Change: P405S

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1212 1292 3.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189323
Predicted Effect probably damaging
Transcript: ENSMUST00000191275
AA Change: P405S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709
AA Change: P405S

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Meta Mutation Damage Score 0.512 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,367,595 Y475H probably damaging Het
Adamts12 G T 15: 11,327,701 G1388V probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap26 T C 18: 39,296,929 probably null Het
Atp7b T A 8: 22,028,601 I74F probably damaging Het
Bod1l A G 5: 41,819,994 Y1326H probably benign Het
Card11 T C 5: 140,885,877 S690G probably damaging Het
Cbx3 A G 6: 51,482,560 E169G possibly damaging Het
Cd28 A T 1: 60,769,702 M192L possibly damaging Het
Chd6 T C 2: 161,029,299 probably benign Het
Cyp2c69 C T 19: 39,877,612 C179Y probably damaging Het
Cyp7b1 A T 3: 18,097,293 V252E probably damaging Het
Dcp2 G T 18: 44,417,592 G378C probably benign Het
Dip2b A T 15: 100,160,529 I196L possibly damaging Het
Etv1 A G 12: 38,831,293 probably null Het
F830104G03Rik T G 3: 56,890,496 K33T unknown Het
Fbln2 C A 6: 91,233,495 H140Q probably damaging Het
Fxr1 A G 3: 34,047,698 T109A probably damaging Het
Gm10110 T C 14: 89,897,349 noncoding transcript Het
Gm9949 C T 18: 62,184,069 probably benign Het
Grin2d A G 7: 45,854,615 L604P probably damaging Het
Gstcd A T 3: 133,005,553 probably benign Het
Ifna16 A G 4: 88,676,444 V138A probably benign Het
Itpr2 T A 6: 146,325,205 N1314I probably damaging Het
Kitl T C 10: 100,080,866 V177A probably damaging Het
L3mbtl1 A T 2: 162,948,568 Q185L probably damaging Het
Lhx9 T A 1: 138,838,354 N232I probably benign Het
Lnx1 T C 5: 74,628,123 R111G probably benign Het
Lrrc41 A G 4: 116,079,405 I72M probably damaging Het
Lrriq1 T A 10: 103,234,038 D39V possibly damaging Het
Lyrm7 A G 11: 54,841,110 probably benign Het
Lyst T A 13: 13,683,149 Y2508N probably damaging Het
Masp2 A T 4: 148,602,871 Y70F probably benign Het
Mc4r T C 18: 66,859,338 I235V probably benign Het
Med12l G A 3: 59,244,793 V1000M probably damaging Het
Morc2b T C 17: 33,138,738 H20R probably benign Het
Ms4a1 A T 19: 11,254,493 S173T probably damaging Het
Myh13 A C 11: 67,337,651 D339A probably damaging Het
Nars A T 18: 64,500,572 Y542* probably null Het
Nectin2 G A 7: 19,717,720 T463I possibly damaging Het
Nrg4 A G 9: 55,259,395 F64L probably benign Het
Nrxn1 T A 17: 91,088,177 I184F probably benign Het
Nxph2 C T 2: 23,399,834 P66L probably benign Het
Olfr1123 C T 2: 87,418,563 Q170* probably null Het
Olfr56 C A 11: 49,134,781 F196L probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Patj A G 4: 98,569,058 I48V possibly damaging Het
Paxbp1 T C 16: 91,044,311 probably benign Het
Pou2f3 A T 9: 43,139,323 N235K possibly damaging Het
Ppp2r2c A G 5: 36,868,870 D17G probably damaging Het
Rgs8 A G 1: 153,692,887 probably benign Het
Rnd3 A G 2: 51,148,750 V42A probably damaging Het
Rp1l1 A G 14: 64,026,171 R247G probably benign Het
Sec31b A T 19: 44,535,733 V156D probably damaging Het
Slc22a2 T A 17: 12,614,815 Y461N possibly damaging Het
Spag6l T C 16: 16,781,758 K280R possibly damaging Het
Spata31d1a A G 13: 59,702,523 L597P probably damaging Het
Srr G T 11: 74,907,780 probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgif1 A C 17: 70,849,705 probably null Het
Tle3 A T 9: 61,373,499 probably benign Het
Tubgcp4 A G 2: 121,189,862 T439A probably benign Het
Twist1 C T 12: 33,958,351 T125M probably damaging Het
Unc13a T A 8: 71,658,616 D317V possibly damaging Het
Vmn1r227 T A 17: 20,735,145 noncoding transcript Het
Vps72 G T 3: 95,118,187 probably benign Het
Zfp184 T C 13: 21,960,328 S735P possibly damaging Het
Zfp42 A T 8: 43,295,688 C259S possibly damaging Het
Zmiz2 A G 11: 6,403,251 H678R probably damaging Het
Other mutations in Erbin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Erbin APN 13 103834012 missense probably damaging 1.00
IGL01404:Erbin APN 13 103839464 missense probably damaging 1.00
IGL01455:Erbin APN 13 103859387 missense probably damaging 1.00
IGL01871:Erbin APN 13 103834766 missense probably damaging 0.98
IGL01930:Erbin APN 13 103841172 missense probably damaging 1.00
IGL02112:Erbin APN 13 103862336 missense probably benign 0.12
IGL02736:Erbin APN 13 103839395 missense probably damaging 1.00
IGL03149:Erbin APN 13 103841163 missense possibly damaging 0.82
IGL03169:Erbin APN 13 103841232 missense possibly damaging 0.93
IGL02802:Erbin UTSW 13 103868130 missense probably damaging 1.00
PIT1430001:Erbin UTSW 13 103859509 missense probably damaging 1.00
R0329:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0330:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0492:Erbin UTSW 13 103834358 missense probably damaging 0.98
R0508:Erbin UTSW 13 103834027 missense probably damaging 1.00
R0589:Erbin UTSW 13 103886287 missense probably damaging 1.00
R1103:Erbin UTSW 13 103886202 missense probably benign 0.00
R1139:Erbin UTSW 13 103884253 missense probably damaging 1.00
R1316:Erbin UTSW 13 103841234 missense possibly damaging 0.94
R1675:Erbin UTSW 13 103841178 missense probably damaging 1.00
R1698:Erbin UTSW 13 103833731 missense possibly damaging 0.91
R1727:Erbin UTSW 13 103827968 missense probably benign 0.01
R1745:Erbin UTSW 13 103839449 missense probably damaging 1.00
R1746:Erbin UTSW 13 103850831 missense probably damaging 1.00
R1764:Erbin UTSW 13 103843451 splice site probably benign
R1828:Erbin UTSW 13 103860069 critical splice donor site probably null
R1840:Erbin UTSW 13 103834947 missense probably benign 0.01
R1987:Erbin UTSW 13 103886203 missense probably benign 0.36
R1992:Erbin UTSW 13 103833713 missense probably benign 0.33
R2013:Erbin UTSW 13 103857533 missense probably damaging 1.00
R2025:Erbin UTSW 13 103830195 missense probably benign 0.01
R2056:Erbin UTSW 13 103830316 missense probably benign 0.27
R2171:Erbin UTSW 13 103834958 missense probably benign 0.00
R2366:Erbin UTSW 13 103844909 missense probably damaging 1.00
R2897:Erbin UTSW 13 103886197 missense probably damaging 1.00
R3912:Erbin UTSW 13 103862287 missense probably benign 0.35
R3912:Erbin UTSW 13 103886338 splice site probably benign
R4073:Erbin UTSW 13 103860111 missense probably damaging 1.00
R4458:Erbin UTSW 13 103833557 missense probably damaging 1.00
R4465:Erbin UTSW 13 103844885 missense probably benign 0.05
R4525:Erbin UTSW 13 103857092 missense probably benign
R4780:Erbin UTSW 13 103884206 missense probably damaging 1.00
R4879:Erbin UTSW 13 103834774 missense probably benign 0.05
R5396:Erbin UTSW 13 103857409 critical splice donor site probably null
R5898:Erbin UTSW 13 103839305 critical splice donor site probably null
R5955:Erbin UTSW 13 103830192 missense probably benign 0.40
R6073:Erbin UTSW 13 103844921 nonsense probably null
R6107:Erbin UTSW 13 103833892 missense probably benign 0.06
R6257:Erbin UTSW 13 103862288 missense probably benign 0.35
R6294:Erbin UTSW 13 103857056 missense probably benign 0.36
R6358:Erbin UTSW 13 103845565 missense probably damaging 1.00
R6476:Erbin UTSW 13 103841247 missense probably damaging 1.00
R6485:Erbin UTSW 13 103868113 missense probably damaging 1.00
R6631:Erbin UTSW 13 103824892 missense probably benign 0.02
R6735:Erbin UTSW 13 103884210 missense probably damaging 1.00
R6736:Erbin UTSW 13 103834766 missense possibly damaging 0.72
R6749:Erbin UTSW 13 103834377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTCAGAGATGTTACTTATCATCC -3'
(R):5'- AGATTTCTCTGTGGTTTCAAATGAG -3'

Sequencing Primer
(F):5'- AACTTTCTAATCCATTTTCCAAACCC -3'
(R):5'- CTAGCTTGCAACTTGACG -3'
Posted On2016-03-17