Incidental Mutation 'R5080:Frrs1'
ID387071
Institutional Source Beutler Lab
Gene Symbol Frrs1
Ensembl Gene ENSMUSG00000033386
Gene Nameferric-chelate reductase 1
SynonymsSdfr2
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116859464-116908177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116902936 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 544 (I544T)
Ref Sequence ENSEMBL: ENSMUSP00000143255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040260] [ENSMUST00000195905] [ENSMUST00000199030]
Predicted Effect probably benign
Transcript: ENSMUST00000040260
AA Change: I544T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000039487
Gene: ENSMUSG00000033386
AA Change: I544T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 32 155 1.1e-34 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195905
AA Change: I544T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000143255
Gene: ENSMUSG00000033386
AA Change: I544T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 31 156 4.6e-40 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197323
Predicted Effect probably benign
Transcript: ENSMUST00000199030
SMART Domains Protein: ENSMUSP00000142793
Gene: ENSMUSG00000033386

DomainStartEndE-ValueType
B561 1 99 1.5e-7 SMART
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the cytochrome b561 (CYB561; MIM 600019) family, including FRRS1, reduce ferric to ferrous iron before its transport from the endosome to the cytoplasm (Vargas et al., 2003 [PubMed 14499595]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Frrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Frrs1 APN 3 116902400 missense probably damaging 1.00
IGL00792:Frrs1 APN 3 116885295 splice site probably null
IGL01395:Frrs1 APN 3 116901005 missense probably benign 0.02
IGL01504:Frrs1 APN 3 116900658 missense probably damaging 1.00
IGL01548:Frrs1 APN 3 116885185 missense probably damaging 1.00
IGL01924:Frrs1 APN 3 116885239 missense probably damaging 1.00
IGL03037:Frrs1 APN 3 116902467 unclassified probably benign
IGL03104:Frrs1 APN 3 116881782 missense probably benign 0.00
IGL03143:Frrs1 APN 3 116899187 missense probably damaging 0.99
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0107:Frrs1 UTSW 3 116896716 missense probably damaging 0.97
R0138:Frrs1 UTSW 3 116881807 missense possibly damaging 0.65
R0532:Frrs1 UTSW 3 116883164 missense probably benign
R0646:Frrs1 UTSW 3 116902421 missense possibly damaging 0.50
R1534:Frrs1 UTSW 3 116878408 missense probably benign 0.14
R1596:Frrs1 UTSW 3 116883199 intron probably benign
R1880:Frrs1 UTSW 3 116896795 critical splice donor site probably null
R2193:Frrs1 UTSW 3 116878345 missense probably damaging 1.00
R2851:Frrs1 UTSW 3 116885129 missense probably benign 0.00
R3177:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3277:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3772:Frrs1 UTSW 3 116878387 missense possibly damaging 0.71
R4457:Frrs1 UTSW 3 116896728 missense probably benign 0.10
R4887:Frrs1 UTSW 3 116902416 makesense probably null
R4957:Frrs1 UTSW 3 116885248 missense probably benign 0.00
R5015:Frrs1 UTSW 3 116878439 missense probably damaging 1.00
R5256:Frrs1 UTSW 3 116903100 missense possibly damaging 0.88
R5280:Frrs1 UTSW 3 116880896 missense probably benign 0.00
R5597:Frrs1 UTSW 3 116878238 start gained probably benign
R5887:Frrs1 UTSW 3 116896750 missense probably benign 0.32
R6210:Frrs1 UTSW 3 116878431 missense probably benign 0.19
R6268:Frrs1 UTSW 3 116903099 missense probably damaging 0.98
R6378:Frrs1 UTSW 3 116900990 missense possibly damaging 0.95
X0063:Frrs1 UTSW 3 116902422 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CACCCACATGTGCATATGC -3'
(R):5'- TGATCATCATGACCCAGGCC -3'

Sequencing Primer
(F):5'- GCATATGCACACACATGCC -3'
(R):5'- GTGGTTGATTGCAGATAAGAATATCG -3'
Posted On2016-06-06