Incidental Mutation 'R5080:Pcdh17'
ID387095
Institutional Source Beutler Lab
Gene Symbol Pcdh17
Ensembl Gene ENSMUSG00000035566
Gene Nameprotocadherin 17
SynonymsC030033F14Rik, LOC219228
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location84443563-84539002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84533310 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1076 (Y1076C)
Ref Sequence ENSEMBL: ENSMUSP00000071325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071370]
Predicted Effect probably benign
Transcript: ENSMUST00000071370
AA Change: Y1076C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: Y1076C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 54 131 6.8e-4 SMART
CA 155 242 8.81e-21 SMART
CA 266 350 8.27e-26 SMART
CA 375 468 9.14e-28 SMART
CA 492 579 8.4e-27 SMART
CA 608 687 2.53e-12 SMART
low complexity region 703 725 N/A INTRINSIC
low complexity region 751 759 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Pcdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pcdh17 APN 14 84447544 missense probably damaging 1.00
IGL00902:Pcdh17 APN 14 84446849 missense probably damaging 1.00
IGL01596:Pcdh17 APN 14 84448192 missense probably damaging 1.00
IGL01665:Pcdh17 APN 14 84447002 missense probably damaging 0.99
IGL01944:Pcdh17 APN 14 84447520 missense probably benign 0.01
IGL01944:Pcdh17 APN 14 84447521 missense probably damaging 0.98
IGL01977:Pcdh17 APN 14 84533097 missense possibly damaging 0.49
IGL01988:Pcdh17 APN 14 84446622 missense probably damaging 1.00
IGL02168:Pcdh17 APN 14 84533195 missense probably benign 0.19
IGL02500:Pcdh17 APN 14 84533469 missense probably benign 0.17
IGL02874:Pcdh17 APN 14 84448240 missense possibly damaging 0.71
IGL02882:Pcdh17 APN 14 84446661 missense probably damaging 0.98
IGL02941:Pcdh17 APN 14 84448307 missense probably damaging 1.00
IGL03328:Pcdh17 APN 14 84533111 missense probably benign
R0226:Pcdh17 UTSW 14 84448201 missense probably damaging 0.99
R0537:Pcdh17 UTSW 14 84447457 missense probably damaging 1.00
R0647:Pcdh17 UTSW 14 84447773 missense possibly damaging 0.58
R0939:Pcdh17 UTSW 14 84447755 missense probably damaging 1.00
R1014:Pcdh17 UTSW 14 84447488 missense probably damaging 1.00
R1753:Pcdh17 UTSW 14 84477654 missense probably benign 0.17
R3404:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3405:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3406:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3746:Pcdh17 UTSW 14 84533037 missense probably benign 0.02
R3852:Pcdh17 UTSW 14 84447259 nonsense probably null
R4015:Pcdh17 UTSW 14 84447107 missense probably damaging 0.99
R4348:Pcdh17 UTSW 14 84447620 missense probably damaging 0.97
R4365:Pcdh17 UTSW 14 84448286 missense probably damaging 0.97
R4375:Pcdh17 UTSW 14 84448271 missense possibly damaging 0.80
R4693:Pcdh17 UTSW 14 84533520 missense probably damaging 1.00
R4811:Pcdh17 UTSW 14 84447935 missense probably damaging 1.00
R5007:Pcdh17 UTSW 14 84533297 missense probably benign
R5074:Pcdh17 UTSW 14 84533342 missense probably benign
R5138:Pcdh17 UTSW 14 84447209 missense probably damaging 1.00
R5330:Pcdh17 UTSW 14 84533046 missense probably damaging 1.00
R5541:Pcdh17 UTSW 14 84447416 missense probably damaging 0.97
R5686:Pcdh17 UTSW 14 84532993 missense probably damaging 1.00
R5692:Pcdh17 UTSW 14 84448540 missense probably benign 0.22
R5695:Pcdh17 UTSW 14 84446360 missense probably damaging 1.00
R5949:Pcdh17 UTSW 14 84447556 missense probably damaging 1.00
R6127:Pcdh17 UTSW 14 84533060 missense probably damaging 0.96
R6294:Pcdh17 UTSW 14 84477668 missense probably benign 0.01
R6508:Pcdh17 UTSW 14 84447979 missense probably damaging 1.00
R6726:Pcdh17 UTSW 14 84446217 missense probably damaging 1.00
R7094:Pcdh17 UTSW 14 84447395 missense not run
R7137:Pcdh17 UTSW 14 84533549 missense not run
X0025:Pcdh17 UTSW 14 84446562 missense possibly damaging 0.86
X0026:Pcdh17 UTSW 14 84533097 missense possibly damaging 0.49
X0027:Pcdh17 UTSW 14 84448310 missense possibly damaging 0.80
Z1088:Pcdh17 UTSW 14 84448274 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CGAGAGCACACTATTCTCATTGC -3'
(R):5'- CAACTTCTTCGGCATCCACG -3'

Sequencing Primer
(F):5'- GAGCACACTATTCTCATTGCCAATG -3'
(R):5'- TTCGGCATCCACGGACTC -3'
Posted On2016-06-06