Incidental Mutation 'R5102:Rara'
ID392436
Institutional Source Beutler Lab
Gene Symbol Rara
Ensembl Gene ENSMUSG00000037992
Gene Nameretinoic acid receptor, alpha
SynonymsRAR alpha 1, RARalpha1
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98927818-98974942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98966359 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 64 (Q64L)
Ref Sequence ENSEMBL: ENSMUSP00000129791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068133] [ENSMUST00000107473] [ENSMUST00000107474] [ENSMUST00000107475] [ENSMUST00000164748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068133
AA Change: Q64L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069744
Gene: ENSMUSG00000037992
AA Change: Q64L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107473
AA Change: Q61L

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103097
Gene: ENSMUSG00000037992
AA Change: Q61L

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
ZnF_C4 82 153 7.53e-40 SMART
HOLI 227 385 1.22e-34 SMART
low complexity region 422 433 N/A INTRINSIC
low complexity region 436 459 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107474
AA Change: Q64L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103098
Gene: ENSMUSG00000037992
AA Change: Q64L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107475
AA Change: Q64L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103099
Gene: ENSMUSG00000037992
AA Change: Q64L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164748
AA Change: Q64L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129791
Gene: ENSMUSG00000037992
AA Change: Q64L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for targeted null mutations show high neonatal mortality due to maternal cannibalization, failure to thrive, and excess mortality during the postnatal period. Male survivors exhibit testicular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Slc7a4 T C 16: 17,575,618 T106A probably damaging Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Rara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Rara APN 11 98968166 missense probably benign 0.00
IGL01155:Rara APN 11 98968184 missense possibly damaging 0.92
IGL02141:Rara APN 11 98968081 missense probably damaging 1.00
IGL03194:Rara APN 11 98971664 missense possibly damaging 0.96
PIT4486001:Rara UTSW 11 98973495 missense possibly damaging 0.88
R0626:Rara UTSW 11 98971580 critical splice acceptor site probably null
R1973:Rara UTSW 11 98971670 missense possibly damaging 0.91
R3975:Rara UTSW 11 98970569 missense probably damaging 1.00
R4357:Rara UTSW 11 98968111 missense probably damaging 0.98
R5147:Rara UTSW 11 98950724 missense probably benign 0.35
R5381:Rara UTSW 11 98971584 missense possibly damaging 0.93
R5570:Rara UTSW 11 98972652 missense probably damaging 1.00
R5861:Rara UTSW 11 98968161 nonsense probably null
R6273:Rara UTSW 11 98970222 missense probably benign 0.00
R6404:Rara UTSW 11 98961013 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGCTGAGTCCTGGGTCATAG -3'
(R):5'- ATCTGACCCAGACTGTCCTC -3'

Sequencing Primer
(F):5'- GGACTGAATGTTTAACTGTCAGCC -3'
(R):5'- AGACTGTCCTCCTCCGACTTG -3'
Posted On2016-06-15