Incidental Mutation 'R5102:Slc7a4'
ID392445
Institutional Source Beutler Lab
Gene Symbol Slc7a4
Ensembl Gene ENSMUSG00000022756
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Synonyms
MMRRC Submission 042690-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R5102 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17572018-17583214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17575618 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 106 (T106A)
Ref Sequence ENSEMBL: ENSMUSP00000156166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000063544] [ENSMUST00000090165] [ENSMUST00000164545] [ENSMUST00000164623] [ENSMUST00000171002] [ENSMUST00000172164] [ENSMUST00000231283] [ENSMUST00000231552] [ENSMUST00000231615] [ENSMUST00000231645] [ENSMUST00000231806] [ENSMUST00000232186] [ENSMUST00000232226] [ENSMUST00000232336] [ENSMUST00000232385]
Predicted Effect probably benign
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063544
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067243
Gene: ENSMUSG00000022756
AA Change: T106A

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 436 1.4e-49 PFAM
Pfam:AA_permease 41 426 9.4e-38 PFAM
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090165
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087627
Gene: ENSMUSG00000022756
AA Change: T106A

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 368 1.2e-42 PFAM
Pfam:AA_permease 41 370 2.7e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116648
Predicted Effect probably damaging
Transcript: ENSMUST00000164545
AA Change: T171A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130375
Gene: ENSMUSG00000022756
AA Change: T171A

DomainStartEndE-ValueType
Pfam:AA_permease_2 102 231 9.8e-15 PFAM
Pfam:AA_permease 106 230 2.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164623
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133167
Gene: ENSMUSG00000022756
AA Change: T106A

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 140 1.5e-14 PFAM
Pfam:AA_permease 41 140 6.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172164
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127280
Gene: ENSMUSG00000022756
AA Change: T106A

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 498 2.6e-46 PFAM
Pfam:AA_permease 41 423 4.5e-36 PFAM
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231283
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231552
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231615
AA Change: T106A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231645
AA Change: T171A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000231806
Predicted Effect probably benign
Transcript: ENSMUST00000232186
Predicted Effect probably damaging
Transcript: ENSMUST00000232226
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232336
Predicted Effect probably damaging
Transcript: ENSMUST00000232385
AA Change: T106A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232429
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik A G 5: 124,338,891 N83D probably damaging Het
Aox4 C T 1: 58,240,778 R518C probably damaging Het
Apbb2 A T 5: 66,312,249 probably null Het
Arhgap45 C T 10: 80,021,428 P254S probably benign Het
Arl4c T C 1: 88,701,600 D22G probably damaging Het
Asxl1 A G 2: 153,400,955 T1142A probably benign Het
BC035044 T C 6: 128,884,986 probably benign Het
Bmp4 T C 14: 46,384,001 N362S probably damaging Het
Cbll1 G T 12: 31,487,913 T280N probably damaging Het
Cdh10 A T 15: 18,986,885 T401S probably benign Het
Cps1 A T 1: 67,206,793 M1148L probably benign Het
Crybg1 T C 10: 43,997,836 D1092G probably damaging Het
Cyth2 A G 7: 45,810,702 S173P probably damaging Het
D3Ertd254e G A 3: 36,162,665 C55Y possibly damaging Het
D6Ertd527e A T 6: 87,111,811 I319F unknown Het
Dchs1 A T 7: 105,772,177 H345Q probably benign Het
Ddx50 A T 10: 62,640,861 V211E probably damaging Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnajb5 G A 4: 42,956,639 D109N possibly damaging Het
Dner A T 1: 84,405,970 N564K probably damaging Het
Fam234b T C 6: 135,209,284 S97P probably benign Het
Fam53b G A 7: 132,715,955 R60* probably null Het
Fmo3 T G 1: 162,963,977 K244Q probably benign Het
Gm12800 T C 4: 101,909,239 F40S probably damaging Het
Golim4 A G 3: 75,903,272 I192T possibly damaging Het
Gpr1 A G 1: 63,183,167 V303A probably damaging Het
Gprin1 T C 13: 54,739,763 M233V probably benign Het
Gtf2f1 A T 17: 57,003,626 V443D probably damaging Het
H2afy C G 13: 56,096,123 probably null Het
Hmgcs2 T C 3: 98,280,470 probably benign Het
Ide T A 19: 37,314,984 I271L unknown Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif14 A G 1: 136,516,403 I1378V probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lhx6 T C 2: 36,094,210 probably null Het
Lrp2 C T 2: 69,489,158 G2007D probably damaging Het
Lrp5 T C 19: 3,659,304 K142R probably damaging Het
Mrpl2 G A 17: 46,650,038 R286Q probably benign Het
Nacad T A 11: 6,598,528 D1402V probably damaging Het
Ndfip2 T C 14: 105,298,105 I275T possibly damaging Het
Neb A C 2: 52,226,570 V4131G possibly damaging Het
Nfe2l1 G A 11: 96,822,108 A83V probably damaging Het
Nos3 A G 5: 24,371,627 D418G probably damaging Het
Olfr1126 A T 2: 87,457,794 M210L probably benign Het
Olfr353 T A 2: 36,890,044 K268M possibly damaging Het
Plcd4 A G 1: 74,565,154 T764A probably damaging Het
Plppr3 G T 10: 79,865,386 P541T possibly damaging Het
Polr2a A G 11: 69,746,945 I191T possibly damaging Het
Rab11fip1 T C 8: 27,156,374 K225E probably damaging Het
Rara A T 11: 98,966,359 Q64L possibly damaging Het
Rtkn G A 6: 83,149,773 V305M probably damaging Het
Sh2b1 A C 7: 126,471,236 F399V probably benign Het
Srcap G A 7: 127,530,623 G539D probably damaging Het
Stab1 C T 14: 31,148,017 probably null Het
Other mutations in Slc7a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02717:Slc7a4 APN 16 17574575 missense possibly damaging 0.90
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0402:Slc7a4 UTSW 16 17575633 missense probably damaging 1.00
R1426:Slc7a4 UTSW 16 17573944 critical splice donor site probably null
R1926:Slc7a4 UTSW 16 17575704 missense probably damaging 1.00
R2097:Slc7a4 UTSW 16 17573455 splice site probably null
R2140:Slc7a4 UTSW 16 17574544 missense possibly damaging 0.91
R4496:Slc7a4 UTSW 16 17575812 missense probably damaging 1.00
R4548:Slc7a4 UTSW 16 17575345 missense probably benign 0.01
R4570:Slc7a4 UTSW 16 17574277 missense probably benign 0.00
R4631:Slc7a4 UTSW 16 17574391 missense probably damaging 1.00
R4658:Slc7a4 UTSW 16 17575933 missense probably damaging 1.00
R4825:Slc7a4 UTSW 16 17574521 missense probably damaging 1.00
R5364:Slc7a4 UTSW 16 17573363 missense probably benign 0.33
R5650:Slc7a4 UTSW 16 17575684 missense possibly damaging 0.94
R5666:Slc7a4 UTSW 16 17575951 utr 5 prime probably benign
R5944:Slc7a4 UTSW 16 17574356 missense possibly damaging 0.95
R6769:Slc7a4 UTSW 16 17575320 missense possibly damaging 0.72
R7381:Slc7a4 UTSW 16 17575056 missense probably damaging 0.99
R7470:Slc7a4 UTSW 16 17575113 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CACGAGTAAAATGCCAGCGG -3'
(R):5'- CACTGGACTTGACTCTACTGG -3'

Sequencing Primer
(F):5'- GCCAGCGGCCAGAAAATCTG -3'
(R):5'- ACTTGACTCTACTGGGTGTGG -3'
Posted On2016-06-15