Incidental Mutation 'R0448:Pggt1b'
ID39485
Institutional Source Beutler Lab
Gene Symbol Pggt1b
Ensembl Gene ENSMUSG00000024477
Gene Nameprotein geranylgeranyltransferase type I, beta subunit
SynonymsBGG1, GGT1, 2010207C17Rik
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R0448 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46239949-46280850 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 46262972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025354]
Predicted Effect probably benign
Transcript: ENSMUST00000025354
SMART Domains Protein: ENSMUSP00000025354
Gene: ENSMUSG00000024477

DomainStartEndE-ValueType
Pfam:Prenyltrans 142 186 8.6e-10 PFAM
Pfam:Prenyltrans 191 234 2.2e-10 PFAM
Pfam:Prenyltrans 240 284 4.8e-10 PFAM
Pfam:Prenyltrans 289 333 4e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein geranylgeranyltransferase type I (GGTase-I) transfers a geranylgeranyl group to the cysteine residue of candidate proteins containing a C-terminal CAAX motif in which 'A' is an aliphatic amino acid and 'X' is leucine (summarized by Zhang et al., 1994 [PubMed 8106351]). The enzyme is composed of a 48-kD alpha subunit (FNTA; MIM 134635) and a 43-kD beta subunit, encoded by the PGGT1B gene. The FNTA gene encodes the alpha subunit for both GGTase-I and the related enzyme farnesyltransferase.[supplied by OMIM, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene blocks proliferation of primary mouse fibroblasts, disrupts the actin cytoskeleton, and results in altered cell morphology and reduced cell migration in a standard wound healing assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Pggt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pggt1b APN 18 46280719 missense probably benign 0.06
IGL02012:Pggt1b APN 18 46262955 missense probably benign
P0035:Pggt1b UTSW 18 46259720 missense probably damaging 1.00
R0140:Pggt1b UTSW 18 46258083 critical splice donor site probably null
R2097:Pggt1b UTSW 18 46246628 missense probably benign
R4010:Pggt1b UTSW 18 46248936 missense possibly damaging 0.93
R4839:Pggt1b UTSW 18 46258099 missense possibly damaging 0.50
R5947:Pggt1b UTSW 18 46248940 missense probably benign 0.25
R6225:Pggt1b UTSW 18 46274607 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCTCTCCTGAGAAACAAGAGCCCAG -3'
(R):5'- GAGCCTGTTGTATGAGCTGTTCCC -3'

Sequencing Primer
(F):5'- GCAAGTTCACTGTCTGCAAAG -3'
(R):5'- ttcaacccccagcaccc -3'
Posted On2013-05-23