Incidental Mutation 'R5159:Prkag3'
ID396858
Institutional Source Beutler Lab
Gene Symbol Prkag3
Ensembl Gene ENSMUSG00000006542
Gene Nameprotein kinase, AMP-activated, gamma 3 non-catalytic subunit
SynonymsAMPKg3L, AMPKg3, AMPKg3S
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74738922-74749221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74741487 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 396 (Y396N)
Ref Sequence ENSEMBL: ENSMUSP00000139909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027356] [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000160732] [ENSMUST00000162093] [ENSMUST00000188073]
Predicted Effect probably benign
Transcript: ENSMUST00000027356
SMART Domains Protein: ENSMUSP00000027356
Gene: ENSMUSG00000026170

DomainStartEndE-ValueType
Pfam:p450 63 529 5.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081636
AA Change: Y396N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542
AA Change: Y396N

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113672
AA Change: Y371N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542
AA Change: Y371N

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160732
AA Change: Y396N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542
AA Change: Y396N

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162093
SMART Domains Protein: ENSMUSP00000125242
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188073
AA Change: Y396N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542
AA Change: Y396N

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190781
Meta Mutation Damage Score 0.51 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. It is dominantly expressed in skeletal muscle. Studies of the pig counterpart suggest that this subunit may play a key role in the regulation of energy metabolism in skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired glycogen synthesis after exercise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Prkag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Prkag3 APN 1 74748812 splice site probably benign
IGL02139:Prkag3 APN 1 74740724 missense probably benign 0.14
P0023:Prkag3 UTSW 1 74740739 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0256:Prkag3 UTSW 1 74741171 missense probably benign 0.01
R0547:Prkag3 UTSW 1 74744720 critical splice donor site probably null
R1314:Prkag3 UTSW 1 74747184 missense probably damaging 1.00
R1484:Prkag3 UTSW 1 74740760 missense probably damaging 1.00
R2842:Prkag3 UTSW 1 74741175 missense probably benign 0.30
R4739:Prkag3 UTSW 1 74740705 makesense probably null
R5876:Prkag3 UTSW 1 74748816 critical splice donor site probably benign
R5989:Prkag3 UTSW 1 74741274 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACACTCATGTCTAGGTGG -3'
(R):5'- CTGAAGTCAGGCATCTTAATGATG -3'

Sequencing Primer
(F):5'- CCACACTCATGTCTAGGTGGTTGTAG -3'
(R):5'- ATGATGCTAAATCTATCTGATGCCCC -3'
Posted On2016-06-21