Incidental Mutation 'R5238:Mst1r'
ID 400513
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Name macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms Fv2, Ron, STK, friend virus susceptibility 2, CDw136, Fv-2, PTK8
MMRRC Submission 042809-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R5238 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107784072-107797582 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107784773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 144 (C144S)
Ref Sequence ENSEMBL: ENSMUSP00000142201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035202] [ENSMUST00000035203] [ENSMUST00000191906] [ENSMUST00000195617]
AlphaFold Q62190
Predicted Effect probably benign
Transcript: ENSMUST00000035202
SMART Domains Protein: ENSMUSP00000035202
Gene: ENSMUSG00000032583

DomainStartEndE-ValueType
Pfam:Mon1 151 555 1.2e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000035203
AA Change: C144S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: C144S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158380
Predicted Effect probably benign
Transcript: ENSMUST00000191906
SMART Domains Protein: ENSMUSP00000141516
Gene: ENSMUSG00000032583

DomainStartEndE-ValueType
Pfam:Mon1 146 461 1.1e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195617
AA Change: C144S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584
AA Change: C144S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,210,142 (GRCm39) probably null Het
Adamtsl5 C T 10: 80,181,192 (GRCm39) G63D probably damaging Het
Armc9 T A 1: 86,127,569 (GRCm39) M68K probably benign Het
Atad2 A C 15: 57,971,733 (GRCm39) H381Q possibly damaging Het
Bclaf1 T G 10: 20,208,130 (GRCm39) probably benign Het
Ccdc188 A G 16: 18,037,038 (GRCm39) E238G probably damaging Het
Cldn19 G T 4: 119,112,930 (GRCm39) C54F probably damaging Het
Clip1 T C 5: 123,785,946 (GRCm39) D246G probably damaging Het
Col20a1 T C 2: 180,640,379 (GRCm39) V512A probably damaging Het
Cyfip1 G T 7: 55,541,779 (GRCm39) A355S probably benign Het
Dffa T G 4: 149,188,760 (GRCm39) L18R probably benign Het
Dnah8 G A 17: 31,009,891 (GRCm39) E3761K probably damaging Het
Dusp10 A G 1: 183,769,210 (GRCm39) T59A possibly damaging Het
Eed T C 7: 89,626,173 (GRCm39) S67G probably benign Het
Fam181a C T 12: 103,282,392 (GRCm39) A99V probably benign Het
Gm12185 G A 11: 48,799,044 (GRCm39) T483I possibly damaging Het
Htr3b A T 9: 48,848,542 (GRCm39) C234* probably null Het
Kidins220 C A 12: 25,053,009 (GRCm39) T433K probably benign Het
Man2a1 T C 17: 64,943,502 (GRCm39) Y186H probably damaging Het
Mcm9 G T 10: 53,506,093 (GRCm39) S60R possibly damaging Het
Nckap5 A G 1: 125,955,461 (GRCm39) C364R probably damaging Het
Nptx2 T C 5: 144,493,041 (GRCm39) I376T probably damaging Het
Or2a14 T C 6: 43,130,961 (GRCm39) S241P probably damaging Het
Otogl A T 10: 107,604,834 (GRCm39) C2191S probably damaging Het
Plxdc2 T A 2: 16,655,026 (GRCm39) F208L probably damaging Het
Robo3 A C 9: 37,328,175 (GRCm39) Y1339D probably damaging Het
Rsph9 G T 17: 46,446,008 (GRCm39) Y42* probably null Het
Slc39a1 T A 3: 90,156,702 (GRCm39) L86Q probably null Het
Slfn8 T C 11: 82,904,214 (GRCm39) D392G probably damaging Het
Tiprl A G 1: 165,043,337 (GRCm39) V263A probably benign Het
Tmub2 A G 11: 102,175,820 (GRCm39) probably benign Het
Trpm1 T A 7: 63,918,702 (GRCm39) F681I probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Uba3 A T 6: 97,178,896 (GRCm39) C68* probably null Het
Vmn1r158 T A 7: 22,489,799 (GRCm39) M137L probably benign Het
Vmn1r50 C T 6: 90,084,465 (GRCm39) A70V possibly damaging Het
Wwc1 T C 11: 35,766,723 (GRCm39) K511E probably benign Het
Zfp600 T C 4: 146,131,741 (GRCm39) probably null Het
Zng1 G T 19: 24,897,994 (GRCm39) T382K probably damaging Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107,790,449 (GRCm39) splice site probably benign
IGL01327:Mst1r APN 9 107,785,043 (GRCm39) missense probably benign 0.03
IGL01572:Mst1r APN 9 107,788,791 (GRCm39) missense probably damaging 1.00
IGL01968:Mst1r APN 9 107,794,005 (GRCm39) splice site probably null
IGL01983:Mst1r APN 9 107,794,475 (GRCm39) missense probably damaging 0.99
IGL02096:Mst1r APN 9 107,794,478 (GRCm39) missense probably damaging 0.97
IGL02203:Mst1r APN 9 107,785,068 (GRCm39) missense probably damaging 1.00
IGL02203:Mst1r APN 9 107,790,348 (GRCm39) missense possibly damaging 0.61
IGL02332:Mst1r APN 9 107,785,025 (GRCm39) nonsense probably null
IGL02402:Mst1r APN 9 107,794,026 (GRCm39) missense probably damaging 0.99
IGL02404:Mst1r APN 9 107,790,266 (GRCm39) splice site probably benign
IGL02942:Mst1r APN 9 107,790,352 (GRCm39) missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107,785,403 (GRCm39) missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107,790,379 (GRCm39) missense probably benign 0.20
IGL03005:Mst1r APN 9 107,791,748 (GRCm39) nonsense probably null
IGL03304:Mst1r APN 9 107,785,137 (GRCm39) missense probably damaging 1.00
R0386:Mst1r UTSW 9 107,794,003 (GRCm39) splice site probably null
R0833:Mst1r UTSW 9 107,791,975 (GRCm39) missense probably benign 0.00
R0833:Mst1r UTSW 9 107,790,366 (GRCm39) missense probably benign
R1139:Mst1r UTSW 9 107,797,168 (GRCm39) missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107,794,424 (GRCm39) missense probably damaging 1.00
R1477:Mst1r UTSW 9 107,785,523 (GRCm39) missense probably benign
R1479:Mst1r UTSW 9 107,790,544 (GRCm39) splice site probably benign
R1541:Mst1r UTSW 9 107,794,562 (GRCm39) missense probably damaging 0.99
R1698:Mst1r UTSW 9 107,797,179 (GRCm39) missense probably benign 0.06
R1891:Mst1r UTSW 9 107,790,661 (GRCm39) missense probably damaging 1.00
R1971:Mst1r UTSW 9 107,790,411 (GRCm39) missense probably benign 0.06
R1974:Mst1r UTSW 9 107,793,132 (GRCm39) critical splice donor site probably null
R1974:Mst1r UTSW 9 107,791,962 (GRCm39) missense probably damaging 1.00
R2144:Mst1r UTSW 9 107,790,367 (GRCm39) missense probably benign
R2221:Mst1r UTSW 9 107,785,547 (GRCm39) missense probably damaging 1.00
R2356:Mst1r UTSW 9 107,795,069 (GRCm39) missense probably damaging 1.00
R3913:Mst1r UTSW 9 107,791,945 (GRCm39) missense probably benign
R4768:Mst1r UTSW 9 107,788,849 (GRCm39) missense probably damaging 1.00
R4793:Mst1r UTSW 9 107,797,124 (GRCm39) missense probably damaging 0.96
R5141:Mst1r UTSW 9 107,789,440 (GRCm39) missense probably damaging 0.99
R5191:Mst1r UTSW 9 107,788,750 (GRCm39) missense probably damaging 0.98
R6024:Mst1r UTSW 9 107,785,350 (GRCm39) missense probably benign 0.00
R6220:Mst1r UTSW 9 107,784,547 (GRCm39) missense probably benign 0.11
R6256:Mst1r UTSW 9 107,794,465 (GRCm39) missense probably damaging 1.00
R6361:Mst1r UTSW 9 107,793,052 (GRCm39) missense probably benign
R6522:Mst1r UTSW 9 107,790,438 (GRCm39) missense probably benign 0.00
R6559:Mst1r UTSW 9 107,785,470 (GRCm39) missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107,797,225 (GRCm39) missense probably benign
R6868:Mst1r UTSW 9 107,793,132 (GRCm39) critical splice donor site probably null
R6873:Mst1r UTSW 9 107,788,843 (GRCm39) missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107,789,793 (GRCm39) missense probably benign 0.23
R7168:Mst1r UTSW 9 107,785,392 (GRCm39) missense probably benign 0.01
R7299:Mst1r UTSW 9 107,791,989 (GRCm39) missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107,791,989 (GRCm39) missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107,792,321 (GRCm39) missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107,797,211 (GRCm39) missense probably benign 0.05
R7684:Mst1r UTSW 9 107,788,762 (GRCm39) missense probably benign 0.01
R7741:Mst1r UTSW 9 107,784,319 (GRCm39) start gained probably benign
R7916:Mst1r UTSW 9 107,784,777 (GRCm39) missense probably damaging 1.00
R7987:Mst1r UTSW 9 107,789,997 (GRCm39) splice site probably null
R8177:Mst1r UTSW 9 107,784,784 (GRCm39) missense probably damaging 1.00
R8356:Mst1r UTSW 9 107,794,463 (GRCm39) missense probably damaging 1.00
R8494:Mst1r UTSW 9 107,791,718 (GRCm39) missense possibly damaging 0.90
R8692:Mst1r UTSW 9 107,792,050 (GRCm39) missense possibly damaging 0.82
R8979:Mst1r UTSW 9 107,792,478 (GRCm39) missense probably damaging 0.98
R9012:Mst1r UTSW 9 107,791,960 (GRCm39) missense probably benign 0.01
X0026:Mst1r UTSW 9 107,790,402 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAATCACCTGCACGTGCTTG -3'
(R):5'- CTAAAGCTAGCGGCCAACTCTG -3'

Sequencing Primer
(F):5'- GCCTGACCTGCAGTTCATAGAG -3'
(R):5'- CCAACTCTGGGTCTAGCGAAGATG -3'
Posted On 2016-07-06