Incidental Mutation 'R1971:Mst1r'
ID220901
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Namemacrophage stimulating 1 receptor (c-met-related tyrosine kinase)
SynonymsFv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107906873-107920383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107913212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 675 (I675F)
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
Predicted Effect probably benign
Transcript: ENSMUST00000035203
AA Change: I675F

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: I675F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195113
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1479:Mst1r UTSW 9 107913345 splice site probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2221:Mst1r UTSW 9 107908348 missense probably damaging 1.00
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6220:Mst1r UTSW 9 107907348 missense probably benign 0.11
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
R7168:Mst1r UTSW 9 107908193 missense probably benign 0.01
R7299:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTTCAGAGAAGCCTCGTG -3'
(R):5'- TCAAGGGTGAGATAAGTACCCC -3'

Sequencing Primer
(F):5'- GTTCAGAGAAGCCTCGTGACTTAC -3'
(R):5'- GGTGAGATAAGTACCCCCAGCC -3'
Posted On2014-08-25