Incidental Mutation 'R5264:Sema3e'
ID401592
Institutional Source Beutler Lab
Gene Symbol Sema3e
Ensembl Gene ENSMUSG00000063531
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
SynonymsSemah
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location14025276-14256689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 14226648 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 314 (L314F)
Ref Sequence ENSEMBL: ENSMUSP00000073612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073957]
Predicted Effect probably damaging
Transcript: ENSMUST00000073957
AA Change: L314F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073612
Gene: ENSMUSG00000063531
AA Change: L314F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 58 500 1.85e-194 SMART
PSI 518 573 1.81e-10 SMART
IG 587 673 5.75e-4 SMART
low complexity region 737 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199698
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display abnormal intersomitic vacular development and loss of the normal segmented somite pattern. Homozygous mutants for another allele have Bergmeister papillae on the surface of the optic disc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Sema3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sema3e APN 5 14240572 missense probably damaging 1.00
IGL01068:Sema3e APN 5 14233718 critical splice donor site probably null
IGL01128:Sema3e APN 5 14232115 missense probably damaging 1.00
IGL01134:Sema3e APN 5 14252770 missense probably damaging 1.00
IGL02013:Sema3e APN 5 14230193 missense probably damaging 1.00
IGL02051:Sema3e APN 5 14224310 missense possibly damaging 0.77
IGL02309:Sema3e APN 5 14224390 missense probably damaging 0.98
IGL02636:Sema3e APN 5 14225656 missense probably benign
IGL02702:Sema3e APN 5 14233726 splice site probably benign
IGL03001:Sema3e APN 5 14241043 missense probably benign 0.19
R0011:Sema3e UTSW 5 14144011 nonsense probably null
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0220:Sema3e UTSW 5 14164153 missense possibly damaging 0.56
R0564:Sema3e UTSW 5 14236085 critical splice donor site probably null
R1079:Sema3e UTSW 5 14225655 missense probably benign 0.12
R1187:Sema3e UTSW 5 14232084 missense probably damaging 1.00
R1670:Sema3e UTSW 5 14162185 splice site probably benign
R1736:Sema3e UTSW 5 14210376 missense probably damaging 1.00
R3433:Sema3e UTSW 5 14252714 missense probably benign 0.00
R3831:Sema3e UTSW 5 14226482 missense probably damaging 1.00
R4094:Sema3e UTSW 5 14233690 missense probably benign 0.12
R4580:Sema3e UTSW 5 14233703 missense probably damaging 1.00
R4828:Sema3e UTSW 5 14226640 missense probably damaging 1.00
R4855:Sema3e UTSW 5 14230130 missense probably damaging 0.99
R4884:Sema3e UTSW 5 14225565 missense probably damaging 1.00
R4960:Sema3e UTSW 5 14252632 missense possibly damaging 0.93
R5389:Sema3e UTSW 5 14236085 critical splice donor site probably benign
R5512:Sema3e UTSW 5 14230180 missense probably damaging 1.00
R5642:Sema3e UTSW 5 14162243 missense probably damaging 1.00
R5647:Sema3e UTSW 5 14225553 missense probably damaging 0.99
R5814:Sema3e UTSW 5 14225666 missense probably benign 0.01
R5993:Sema3e UTSW 5 14224293 missense probably damaging 1.00
R6076:Sema3e UTSW 5 14241086 missense probably benign 0.01
R6906:Sema3e UTSW 5 14240587 missense probably damaging 1.00
X0064:Sema3e UTSW 5 14230142 missense probably benign 0.05
Z1088:Sema3e UTSW 5 14226456 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGGTGAACAAGTGGAGCAC -3'
(R):5'- AGCCAGACACTTAAAGCTGC -3'

Sequencing Primer
(F):5'- GGAGCACTTTCCTTAAAGCG -3'
(R):5'- CCAGACACTTAAAGCTGCAGAGAG -3'
Posted On2016-07-06