Incidental Mutation 'R5227:Olfr315'
ID402689
Institutional Source Beutler Lab
Gene Symbol Olfr315
Ensembl Gene ENSMUSG00000056959
Gene Nameolfactory receptor 315
SynonymsMOR278-1, GA_x6K02T2NKPP-630272-629343
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58773188-58780251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58778879 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 251 (F251I)
Ref Sequence ENSEMBL: ENSMUSP00000144944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081533] [ENSMUST00000203256] [ENSMUST00000205189]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081533
AA Change: F251I

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080248
Gene: ENSMUSG00000056959
AA Change: F251I

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 3.5e-51 PFAM
Pfam:7TM_GPCR_Srsx 34 252 1.3e-7 PFAM
Pfam:7tm_1 41 290 6.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203256
AA Change: F251I

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144944
Gene: ENSMUSG00000056959
AA Change: F251I

DomainStartEndE-ValueType
Pfam:7tm_4 29 126 1.2e-13 PFAM
Pfam:7TM_GPCR_Srsx 35 126 1.8e-5 PFAM
Pfam:7tm_1 41 126 4.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205189
SMART Domains Protein: ENSMUSP00000145387
Gene: ENSMUSG00000059504

DomainStartEndE-ValueType
Pfam:7tm_4 26 259 8.9e-42 PFAM
Pfam:7TM_GPCR_Srsx 33 246 9.4e-6 PFAM
Pfam:7tm_1 39 259 1.1e-25 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Olfr315
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Olfr315 APN 11 58778297 missense probably benign 0.21
IGL03265:Olfr315 APN 11 58778871 missense probably damaging 1.00
R0395:Olfr315 UTSW 11 58778369 missense probably benign 0.05
R1760:Olfr315 UTSW 11 58778369 missense possibly damaging 0.79
R1782:Olfr315 UTSW 11 58778805 missense probably damaging 1.00
R2330:Olfr315 UTSW 11 58778999 missense probably damaging 1.00
R3831:Olfr315 UTSW 11 58778745 unclassified probably null
R4898:Olfr315 UTSW 11 58778306 missense possibly damaging 0.60
R6257:Olfr315 UTSW 11 58779003 missense probably damaging 0.96
R7253:Olfr315 UTSW 11 58778996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAACCACTTCTTCTGTGAGGC -3'
(R):5'- TCTGCAGCCACTTCCTCAAG -3'

Sequencing Primer
(F):5'- GCAGACACCAAAGTCTTTGAGTTC -3'
(R):5'- AGCCACTTCCTCAAGGCTCC -3'
Posted On2016-07-22