Incidental Mutation 'R5227:Snx14'
ID402686
Institutional Source Beutler Lab
Gene Symbol Snx14
Ensembl Gene ENSMUSG00000032422
Gene Namesorting nexin 14
SynonymsC330035N22Rik, YR-14
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location88376750-88438958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88398294 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 536 (T536I)
Ref Sequence ENSEMBL: ENSMUSP00000130116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]
Predicted Effect probably benign
Transcript: ENSMUST00000126405
SMART Domains Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PXA 157 210 3.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140439
Predicted Effect possibly damaging
Transcript: ENSMUST00000165315
AA Change: T536I

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: T536I

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 8.2e-49 PFAM
Pfam:RGS 363 495 4.3e-13 PFAM
PX 585 704 8.77e-13 SMART
low complexity region 771 785 N/A INTRINSIC
Pfam:Nexin_C 825 930 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173011
SMART Domains Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 3.1e-49 PFAM
Pfam:RGS 363 482 3.1e-9 PFAM
low complexity region 499 513 N/A INTRINSIC
Pfam:Nexin_C 553 658 7.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173039
AA Change: T492I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: T492I

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 154 286 6.5e-33 PFAM
Pfam:RGS 319 451 2.6e-13 PFAM
PX 541 660 8.77e-13 SMART
low complexity region 727 741 N/A INTRINSIC
Pfam:Nexin_C 781 886 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174806
AA Change: T545I

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: T545I

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 158 327 1.9e-44 PFAM
Pfam:RGS 363 495 1.3e-13 PFAM
PX 594 713 8.77e-13 SMART
low complexity region 780 794 N/A INTRINSIC
Pfam:Nexin_C 834 938 2.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187610
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Emilin3 T A 2: 160,909,265 Q188L probably damaging Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Snx14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Snx14 APN 9 88402190 missense probably damaging 0.99
IGL00773:Snx14 APN 9 88394539 missense probably damaging 0.96
IGL00847:Snx14 APN 9 88420329 missense probably damaging 1.00
IGL01526:Snx14 APN 9 88381500 missense probably damaging 0.99
IGL01662:Snx14 APN 9 88385838 splice site probably benign
IGL01928:Snx14 APN 9 88381512 missense probably benign 0.04
IGL02225:Snx14 APN 9 88413524 missense probably damaging 0.99
IGL02498:Snx14 APN 9 88407464 missense probably damaging 1.00
IGL02585:Snx14 APN 9 88404518 missense possibly damaging 0.92
IGL02634:Snx14 APN 9 88403303 missense probably damaging 1.00
IGL03073:Snx14 APN 9 88422896 critical splice donor site probably null
R0167:Snx14 UTSW 9 88407416 missense probably damaging 1.00
R0324:Snx14 UTSW 9 88405238 critical splice donor site probably null
R0627:Snx14 UTSW 9 88394430 missense probably benign
R0862:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0864:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0974:Snx14 UTSW 9 88400721 critical splice donor site probably null
R1478:Snx14 UTSW 9 88394528 missense probably benign 0.00
R1511:Snx14 UTSW 9 88398364 nonsense probably null
R1522:Snx14 UTSW 9 88402224 missense possibly damaging 0.52
R1612:Snx14 UTSW 9 88376905 missense possibly damaging 0.81
R1634:Snx14 UTSW 9 88385739 missense probably benign 0.00
R1634:Snx14 UTSW 9 88407490 splice site probably benign
R1704:Snx14 UTSW 9 88413538 missense probably damaging 1.00
R1713:Snx14 UTSW 9 88415675 missense probably damaging 1.00
R1883:Snx14 UTSW 9 88402261 missense probably benign 0.01
R3701:Snx14 UTSW 9 88420243 splice site probably benign
R3853:Snx14 UTSW 9 88407319 splice site probably benign
R4301:Snx14 UTSW 9 88410623 missense probably damaging 1.00
R4449:Snx14 UTSW 9 88422999 missense probably benign 0.05
R4793:Snx14 UTSW 9 88394442 missense probably damaging 0.98
R4934:Snx14 UTSW 9 88398288 missense probably damaging 0.98
R5126:Snx14 UTSW 9 88382099 missense probably damaging 1.00
R5518:Snx14 UTSW 9 88383802 missense probably damaging 1.00
R5838:Snx14 UTSW 9 88391776 missense probably damaging 1.00
R5957:Snx14 UTSW 9 88403274 missense possibly damaging 0.84
R6153:Snx14 UTSW 9 88391806 missense probably damaging 1.00
R6156:Snx14 UTSW 9 88407339 missense possibly damaging 0.92
R6703:Snx14 UTSW 9 88422914 missense probably damaging 0.96
R6784:Snx14 UTSW 9 88381792 missense probably benign 0.01
R6823:Snx14 UTSW 9 88394382 missense possibly damaging 0.90
R6837:Snx14 UTSW 9 88380223 missense probably benign 0.07
R7169:Snx14 UTSW 9 88398309 missense probably damaging 0.98
R7216:Snx14 UTSW 9 88381791 missense probably damaging 0.99
R7224:Snx14 UTSW 9 88394561 missense possibly damaging 0.92
R7357:Snx14 UTSW 9 88404316 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATGCATCAAGGTGGGTCTAAGG -3'
(R):5'- ACTTTCCCTTTCATAGCTAGGTAG -3'

Sequencing Primer
(F):5'- GTATGGGGTTAGTACAATGAAACTAC -3'
(R):5'- CTAGGTAGCTTTTTCTTTGGCATTGC -3'
Posted On2016-07-22