Incidental Mutation 'R5345:Srsf9'
ID422551
Institutional Source Beutler Lab
Gene Symbol Srsf9
Ensembl Gene ENSMUSG00000029538
Gene Nameserine/arginine-rich splicing factor 9
SynonymsSfrs9, 2610029M16Rik, SRp30c
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115327177-115333080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115330536 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000031513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031513] [ENSMUST00000139167] [ENSMUST00000149510]
PDB Structure
Solution structure of RRM domain in protein BAB31986 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031513
AA Change: D77G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031513
Gene: ENSMUSG00000029538
AA Change: D77G

DomainStartEndE-ValueType
RRM 16 86 3.76e-19 SMART
RRM 113 179 1.19e-7 SMART
low complexity region 187 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139167
SMART Domains Protein: ENSMUSP00000115090
Gene: ENSMUSG00000029536

DomainStartEndE-ValueType
Pfam:Glu-tRNAGln 69 134 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144000
Predicted Effect probably benign
Transcript: ENSMUST00000149510
SMART Domains Protein: ENSMUSP00000121845
Gene: ENSMUSG00000029538

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
RRM 54 115 3.04e-2 SMART
low complexity region 123 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209604
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cspg5 A T 9: 110,246,630 M145L probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Srsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Srsf9 APN 5 115332128 missense probably damaging 1.00
R0137:Srsf9 UTSW 5 115332201 missense possibly damaging 0.64
R0603:Srsf9 UTSW 5 115332637 missense probably damaging 0.99
R1565:Srsf9 UTSW 5 115327370 missense possibly damaging 0.73
R1781:Srsf9 UTSW 5 115327422 nonsense probably null
R2942:Srsf9 UTSW 5 115332693 missense probably damaging 1.00
R3622:Srsf9 UTSW 5 115330512 missense probably damaging 0.98
R3689:Srsf9 UTSW 5 115327328 missense probably benign 0.00
R4492:Srsf9 UTSW 5 115332592 missense probably damaging 1.00
R5840:Srsf9 UTSW 5 115331465 missense probably benign
R6355:Srsf9 UTSW 5 115327309 start codon destroyed probably null 0.04
R7207:Srsf9 UTSW 5 115327422 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCAGCTGTCAAACTTTGAG -3'
(R):5'- ACACACTTCCTTGAAGGCTAG -3'

Sequencing Primer
(F):5'- ACTTTGAGTAATGTGAACGGCCC -3'
(R):5'- CTAGACTCTCGTTCAGCAAAGTGG -3'
Posted On2016-08-04