Incidental Mutation 'R5345:Cspg5'
ID422563
Institutional Source Beutler Lab
Gene Symbol Cspg5
Ensembl Gene ENSMUSG00000032482
Gene Namechondroitin sulfate proteoglycan 5
SynonymsCALEB, neuroglycan C, NGC
MMRRC Submission 042924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R5345 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110243783-110262576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110246630 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 145 (M145L)
Ref Sequence ENSEMBL: ENSMUSP00000143005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035058] [ENSMUST00000196060] [ENSMUST00000197850] [ENSMUST00000199736]
Predicted Effect probably benign
Transcript: ENSMUST00000035058
AA Change: M145L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035058
Gene: ENSMUSG00000032482
AA Change: M145L

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Chon_Sulph_att 33 278 2.5e-123 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 565 5.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196060
AA Change: M145L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143164
Gene: ENSMUSG00000032482
AA Change: M145L

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 487 8.9e-26 PFAM
Pfam:Neural_ProG_Cyt 486 539 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196176
Predicted Effect probably benign
Transcript: ENSMUST00000197850
AA Change: M145L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143005
Gene: ENSMUSG00000032482
AA Change: M145L

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1.1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 520 1.5e-45 PFAM
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199736
AA Change: M64L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142845
Gene: ENSMUSG00000032482
AA Change: M64L

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 1 197 1.6e-99 PFAM
low complexity region 209 221 N/A INTRINSIC
EGF 292 332 9.5e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 366 406 1.2e-22 PFAM
Pfam:Neural_ProG_Cyt 405 458 1.7e-28 PFAM
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a chondroitin sulfate proteoglycan. The encoded protein has been termed a 'part-time' proteoglycan, as chondroitin sulfate chains appear to be attached to the protein in the developing but not the adult cerebellum and retina. It is thought that this protein plays roles in dendrite branching and synapse formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display decreased spontaneous postsynaptic currents, increased paired-pulse ratios, and reduced long term depression during early postnatal developmental stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,179,177 T158M probably benign Het
Abl1 T A 2: 31,797,047 S519T probably damaging Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acot1 T A 12: 84,017,168 I350N probably damaging Het
Adam8 A G 7: 139,987,639 V397A probably benign Het
Ankar A G 1: 72,670,151 M735T possibly damaging Het
B020031M17Rik A T 13: 119,949,848 V74E probably damaging Het
Cacna1c A G 6: 118,656,536 probably null Het
Cdc25b A G 2: 131,192,596 S222G probably benign Het
Celsr3 T C 9: 108,832,124 S1390P probably damaging Het
Clca4a T G 3: 144,970,461 D104A probably damaging Het
Clcn6 A T 4: 148,038,749 probably benign Het
Coq8b A G 7: 27,250,348 T320A probably benign Het
Cyp2c67 T A 19: 39,626,232 I284F probably benign Het
Eya4 T C 10: 23,110,048 I565V probably benign Het
Fbxw11 A G 11: 32,738,471 N410S probably damaging Het
Gabrb2 C T 11: 42,626,809 A448V possibly damaging Het
Gm11487 A T 4: 73,401,277 W77R probably damaging Het
Hectd4 A G 5: 121,263,974 D375G possibly damaging Het
Itsn2 T C 12: 4,672,783 V1073A probably damaging Het
Kif5c A G 2: 49,723,066 T139A probably benign Het
L1td1 G A 4: 98,736,447 G293D probably damaging Het
Lama1 A G 17: 67,817,563 M2873V probably benign Het
Myo15 A G 11: 60,497,538 R1960G probably damaging Het
Nbeal1 T C 1: 60,328,210 probably null Het
Ndufb4 A G 16: 37,654,178 probably null Het
Nup153 A T 13: 46,686,865 L1089* probably null Het
Olfr1107 A G 2: 87,071,492 V214A possibly damaging Het
Olfr1512 G A 14: 52,372,268 R262* probably null Het
Olfr168 T A 16: 19,530,777 I48F probably damaging Het
P2rx1 A G 11: 73,009,230 T158A probably damaging Het
Park7 A G 4: 150,908,423 probably benign Het
Parl A T 16: 20,298,142 F102I probably damaging Het
Plxnc1 T A 10: 94,849,969 H720L probably benign Het
Ptpn4 A G 1: 119,765,477 S140P probably benign Het
Rel A G 11: 23,742,462 S524P probably benign Het
Ripply2 A G 9: 87,019,726 probably null Het
Rps4l-ps T C 7: 114,927,198 noncoding transcript Het
Rtn4ip1 T C 10: 43,932,470 L81P probably damaging Het
Sap130 T C 18: 31,648,198 L138P probably benign Het
Scp2 A T 4: 108,055,579 probably null Het
Sec24c T A 14: 20,693,220 M970K probably benign Het
Setd5 C T 6: 113,116,007 P340L probably damaging Het
Sgcg A T 14: 61,245,769 M61K probably damaging Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Slc34a1 A G 13: 55,400,518 R21G probably benign Het
Slc7a14 A C 3: 31,223,857 L533W probably damaging Het
Srsf9 A G 5: 115,330,536 D77G probably benign Het
Tab1 A T 15: 80,149,813 E119V possibly damaging Het
Tnrc6c C T 11: 117,723,287 A757V possibly damaging Het
Tradd A T 8: 105,259,924 I72N probably damaging Het
Trbv12-1 C T 6: 41,113,847 T51M probably benign Het
Tsga10 T C 1: 37,763,311 K605E probably damaging Het
Vwc2l A G 1: 70,728,918 D47G probably damaging Het
Zfp647 T A 15: 76,911,495 T322S possibly damaging Het
Zscan20 A C 4: 128,588,121 S583A probably benign Het
Other mutations in Cspg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Cspg5 APN 9 110256168 missense probably damaging 1.00
IGL01516:Cspg5 APN 9 110246693 missense probably benign 0.37
IGL01800:Cspg5 APN 9 110251150 splice site probably benign
IGL01927:Cspg5 APN 9 110262084 missense probably damaging 0.99
IGL02164:Cspg5 APN 9 110251036 missense probably damaging 0.98
IGL02338:Cspg5 APN 9 110256267 missense probably benign 0.04
IGL02421:Cspg5 APN 9 110247392 critical splice donor site probably benign
R0106:Cspg5 UTSW 9 110246532 missense probably damaging 0.96
R0540:Cspg5 UTSW 9 110247392 critical splice donor site probably null
R0905:Cspg5 UTSW 9 110246526 missense probably damaging 0.99
R1772:Cspg5 UTSW 9 110262138 missense probably damaging 1.00
R1959:Cspg5 UTSW 9 110251026 missense probably damaging 1.00
R4356:Cspg5 UTSW 9 110256177 missense probably damaging 1.00
R4771:Cspg5 UTSW 9 110251127 missense probably damaging 1.00
R5441:Cspg5 UTSW 9 110246643 missense probably benign
R5474:Cspg5 UTSW 9 110251008 missense probably damaging 1.00
R5946:Cspg5 UTSW 9 110251083 missense probably damaging 0.99
R6890:Cspg5 UTSW 9 110246784 missense probably damaging 0.98
R7028:Cspg5 UTSW 9 110246891 missense possibly damaging 0.85
R7286:Cspg5 UTSW 9 110246955 missense probably damaging 1.00
X0020:Cspg5 UTSW 9 110247173 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAGATGAGACCTCGTGGAC -3'
(R):5'- CAATGTCAATTATATCTGAGGCTGG -3'

Sequencing Primer
(F):5'- TGAGACCTCGTGGACAGAGC -3'
(R):5'- GTTGGGTCTCGAGAGTGCCC -3'
Posted On2016-08-04