Mutagenetix > Incidental Mutation

Incidental Mutation 'R5348:Robo4'

422740

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

Magic roundabout, 1200012D01Rik

MMRRC Submission

042927-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R5348 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

37313198-37325319 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

CGG to CG at 37322786 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]

AlphaFold

Q8C310

Predicted Effect

probably benign
Transcript: ENSMUST00000034643

SMART Domains

Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
IGc2	54	128	9.7e-11	SMART
IGc2	156	221	1.44e-4	SMART
IGc2	248	311	1.89e-13	SMART
IGc2	337	409	9.84e-12	SMART
IGc2	441	506	2.09e-15	SMART
FN3	534	616	4.24e-14	SMART
FN3	648	731	3.06e0	SMART
FN3	747	832	1.97e-9	SMART
low complexity region	870	890	N/A	INTRINSIC
low complexity region	1055	1082	N/A	INTRINSIC
low complexity region	1131	1149	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC
low complexity region	1193	1206	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
low complexity region	1268	1281	N/A	INTRINSIC
low complexity region	1336	1376	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102895

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115038

SMART Domains

Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
IGc2	76	150	9.7e-11	SMART
IGc2	178	243	1.44e-4	SMART
IGc2	270	333	1.89e-13	SMART
IGc2	359	431	9.84e-12	SMART
IGc2	463	528	2.09e-15	SMART
FN3	556	638	4.24e-14	SMART
FN3	670	753	3.06e0	SMART
FN3	769	854	1.97e-9	SMART
low complexity region	892	912	N/A	INTRINSIC
low complexity region	1077	1104	N/A	INTRINSIC
low complexity region	1153	1171	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
low complexity region	1215	1228	N/A	INTRINSIC
low complexity region	1267	1278	N/A	INTRINSIC
low complexity region	1290	1303	N/A	INTRINSIC
low complexity region	1358	1398	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115046

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115048

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171467

Predicted Effect

probably benign
Transcript: ENSMUST00000170512

Predicted Effect

probably null
Transcript: ENSMUST00000214185

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215777

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg5	A	T	17: 84,978,634 (GRCm39)	C275S	possibly damaging	Het
Bltp1	A	G	3: 37,102,295 (GRCm39)	E1331G	probably damaging	Het
Cdk12	T	A	11: 98,095,118 (GRCm39)	S309T	probably benign	Het
Cep295nl	T	C	11: 118,224,425 (GRCm39)	R140G	probably damaging	Het
Chd8	A	G	14: 52,470,155 (GRCm39)	V485A	probably damaging	Het
Chn2	A	G	6: 54,277,203 (GRCm39)	I279V	probably damaging	Het
Cux2	A	G	5: 122,004,041 (GRCm39)	S1032P	probably damaging	Het
Ddx55	T	A	5: 124,692,628 (GRCm39)	M44K	probably damaging	Het
Dpyd	T	A	3: 118,575,592 (GRCm39)	H143Q	probably benign	Het
Fbxo10	A	G	4: 45,058,934 (GRCm39)	W268R	probably damaging	Het
Gmfg	A	G	7: 28,145,819 (GRCm39)	D86G	probably benign	Het
Gpd1	T	C	15: 99,620,021 (GRCm39)	V273A	possibly damaging	Het
Grhpr	T	C	4: 44,985,393 (GRCm39)	I158T	probably damaging	Het
Itpr2	A	G	6: 146,378,191 (GRCm39)	F53L	possibly damaging	Het
Kctd21	A	G	7: 96,997,177 (GRCm39)	I217V	probably benign	Het
Lrfn2	A	G	17: 49,403,718 (GRCm39)	T614A	probably benign	Het
Lrrc7	T	A	3: 157,880,963 (GRCm39)	D491V	probably benign	Het
Myo7b	T	C	18: 32,116,972 (GRCm39)	E916G	probably damaging	Het
Nf1	C	T	11: 79,455,725 (GRCm39)	T550I	probably damaging	Het
Nsd1	A	G	13: 55,460,147 (GRCm39)	T2125A	probably benign	Het
Olfml2b	A	G	1: 170,489,995 (GRCm39)	E205G	probably benign	Het
Or8k37	A	T	2: 86,469,150 (GRCm39)	L301I	probably benign	Het
Papolb	T	C	5: 142,514,972 (GRCm39)	T224A	possibly damaging	Het
Pcnx2	T	C	8: 126,545,495 (GRCm39)	E1172G	probably damaging	Het
Ppip5k2	A	G	1: 97,675,317 (GRCm39)	L362S	possibly damaging	Het
Ppp1r9b	T	A	11: 94,887,438 (GRCm39)	Y59*	probably null	Het
Pramel12	T	C	4: 143,143,351 (GRCm39)	L39P	probably damaging	Het
Rapgef5	T	A	12: 117,652,346 (GRCm39)	S76R	probably benign	Het
Rnh1	A	T	7: 140,743,321 (GRCm39)	V218D	probably damaging	Het
Slc4a7	G	T	14: 14,786,310 (GRCm38)	V999L	probably benign	Het
Slco4c1	A	T	1: 96,770,254 (GRCm39)	I270N	probably damaging	Het
Tdp1	A	G	12: 99,881,765 (GRCm39)	Y498C	probably damaging	Het
Tfip11	A	G	5: 112,483,534 (GRCm39)	S650G	probably benign	Het
Ttn	T	C	2: 76,608,638 (GRCm39)	T17793A	possibly damaging	Het
Ulk2	T	C	11: 61,674,439 (GRCm39)	T856A	probably benign	Het
Vps13d	C	T	4: 144,792,459 (GRCm39)	G3726E	probably damaging	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37,322,400 (GRCm39)	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37,319,525 (GRCm39)	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37,317,231 (GRCm39)	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37,319,507 (GRCm39)	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37,317,296 (GRCm39)	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37,324,336 (GRCm39)	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37,319,496 (GRCm39)	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37,319,670 (GRCm39)	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37,324,678 (GRCm39)	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37,319,472 (GRCm39)	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37,321,765 (GRCm39)	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37,315,580 (GRCm39)	splice site	probably benign
IGL03102:Robo4	APN	9	37,315,481 (GRCm39)	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37,317,106 (GRCm39)	intron	probably benign
PIT4305001:Robo4	UTSW	9	37,322,687 (GRCm39)	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37,315,773 (GRCm39)	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37,315,773 (GRCm39)	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37,313,977 (GRCm39)	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37,313,977 (GRCm39)	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37,316,062 (GRCm39)	splice site	probably benign
R1005:Robo4	UTSW	9	37,319,547 (GRCm39)	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37,324,348 (GRCm39)	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37,319,348 (GRCm39)	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37,322,136 (GRCm39)	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37,319,372 (GRCm39)	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37,314,523 (GRCm39)	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37,314,739 (GRCm39)	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37,324,355 (GRCm39)	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37,315,366 (GRCm39)	splice site	probably benign
R2203:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2204:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2351:Robo4	UTSW	9	37,322,956 (GRCm39)	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37,313,958 (GRCm39)	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37,315,772 (GRCm39)	nonsense	probably null
R2851:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2852:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2877:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3123:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3124:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3125:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3805:Robo4	UTSW	9	37,315,734 (GRCm39)	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37,315,734 (GRCm39)	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3905:Robo4	UTSW	9	37,314,801 (GRCm39)	nonsense	probably null
R3938:Robo4	UTSW	9	37,313,313 (GRCm39)	start gained	probably benign
R4261:Robo4	UTSW	9	37,316,877 (GRCm39)	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4435:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4561:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4562:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4568:Robo4	UTSW	9	37,316,118 (GRCm39)	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37,314,495 (GRCm39)	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37,313,856 (GRCm39)	missense	probably benign
R5000:Robo4	UTSW	9	37,319,664 (GRCm39)	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37,316,102 (GRCm39)	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37,319,256 (GRCm39)	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37,319,256 (GRCm39)	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5279:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5285:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5347:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5361:Robo4	UTSW	9	37,324,674 (GRCm39)	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5404:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5488:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5489:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5490:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5494:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5629:Robo4	UTSW	9	37,319,658 (GRCm39)	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37,316,093 (GRCm39)	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37,322,970 (GRCm39)	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37,322,696 (GRCm39)	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37,316,926 (GRCm39)	nonsense	probably null
R6189:Robo4	UTSW	9	37,314,829 (GRCm39)	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37,322,008 (GRCm39)	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37,315,664 (GRCm39)	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37,313,363 (GRCm39)	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37,314,001 (GRCm39)	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37,322,277 (GRCm39)	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37,314,105 (GRCm39)	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37,316,870 (GRCm39)	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37,324,418 (GRCm39)	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37,322,055 (GRCm39)	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37,313,931 (GRCm39)	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37,316,936 (GRCm39)	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37,315,372 (GRCm39)	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37,314,801 (GRCm39)	nonsense	probably null
R8547:Robo4	UTSW	9	37,315,674 (GRCm39)	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37,319,577 (GRCm39)	missense	possibly damaging	0.92
R8836:Robo4	UTSW	9	37,317,130 (GRCm39)	missense	unknown
R8889:Robo4	UTSW	9	37,314,601 (GRCm39)	missense	probably benign	0.00
R9018:Robo4	UTSW	9	37,315,520 (GRCm39)	missense	probably benign	0.00
R9182:Robo4	UTSW	9	37,313,206 (GRCm39)	start gained	probably benign
R9375:Robo4	UTSW	9	37,316,158 (GRCm39)	missense	probably damaging	1.00
R9621:Robo4	UTSW	9	37,317,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTGCCCTAACCAGTGTC -3'
(R):5'- GTGAAGACACAGTCAGCTTCC -3'

Sequencing Primer
(F):5'- GTGCCCTAACCAGTGTCCTGTC -3'
(R):5'- ACAGTCAGCTTCCCTGGGATC -3'

Posted On

2016-08-04