Incidental Mutation 'R5279:Robo4'
ID404118
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission 042839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R5279 (G1)
Quality Score217
Status Validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 37411490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]
Predicted Effect probably benign
Transcript: ENSMUST00000034643
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102895
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115046
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115048
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect probably benign
Transcript: ENSMUST00000170512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Predicted Effect probably null
Transcript: ENSMUST00000214185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215777
Meta Mutation Damage Score 0.6196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 C A 17: 24,289,414 G1049V probably damaging Het
Afdn G A 17: 13,888,952 R1579H probably damaging Het
Ankrd28 T A 14: 31,735,006 N386Y probably damaging Het
Atf7ip T A 6: 136,603,379 Y1100* probably null Het
Atp9b T A 18: 80,912,858 E3V probably damaging Het
AW554918 T G 18: 25,175,431 D60E possibly damaging Het
Baz2b G T 2: 59,932,152 Q927K probably damaging Het
Birc6 A G 17: 74,650,047 R3659G probably damaging Het
C8a T G 4: 104,845,988 N291H probably damaging Het
Calcoco1 G A 15: 102,710,985 L390F probably damaging Het
Carmil3 A G 14: 55,501,571 D894G probably damaging Het
Cdc20 A G 4: 118,433,514 Y430H probably damaging Het
Cdc6 A T 11: 98,912,262 I316F probably damaging Het
Cenpu T A 8: 46,578,910 probably null Het
Csmd2 T A 4: 128,456,914 V1592D probably benign Het
Csmd3 G T 15: 48,791,944 probably null Het
Dnah7c T C 1: 46,519,269 F512L probably benign Het
Fam136a T A 6: 86,366,704 L61Q probably damaging Het
Fpgs A C 2: 32,692,767 probably benign Het
Fzd4 G A 7: 89,407,673 M309I probably benign Het
Gad2 A G 2: 22,673,957 T391A probably benign Het
Gm11563 A T 11: 99,658,713 S72T unknown Het
Gm5155 T A 7: 17,873,289 noncoding transcript Het
Gon4l A G 3: 88,887,637 I716V probably benign Het
Itga9 T C 9: 118,628,205 V128A probably damaging Het
Kat6a CGCAGCAGCAGCAGCAGCA CGCAGCAGCAGCA 8: 22,939,648 probably benign Het
Lrrc9 T A 12: 72,495,594 D1063E possibly damaging Het
Lyst T A 13: 13,648,802 L1453* probably null Het
Mcm3ap T C 10: 76,507,539 V1755A probably damaging Het
Mrc1 T C 2: 14,310,058 S985P probably damaging Het
Mst1 A C 9: 108,082,215 K233N probably damaging Het
Nr2c2ap G A 8: 70,132,003 D42N probably damaging Het
Ntn1 A G 11: 68,385,712 S137P probably benign Het
Pard3 T C 8: 127,460,386 probably null Het
Pcdh15 T A 10: 74,594,183 D1210E probably damaging Het
Pcdhga5 T C 18: 37,694,721 L74P probably benign Het
Pcsk5 T C 19: 17,595,658 probably null Het
Pdia3 T C 2: 121,414,003 probably benign Het
Pikfyve A T 1: 65,196,699 R177* probably null Het
Pklr A G 3: 89,143,259 E409G probably damaging Het
Plod2 T C 9: 92,581,323 Y154H probably damaging Het
Psmc3 T A 2: 91,054,322 D6E probably benign Het
Ptpru T A 4: 131,820,023 N205I possibly damaging Het
Rbm6 T C 9: 107,778,014 E1006G probably benign Het
Rgl2 T C 17: 33,935,948 V642A probably benign Het
Rnf8 T A 17: 29,626,706 H104Q possibly damaging Het
Rpa1 T C 11: 75,313,344 N269S probably damaging Het
Sdk2 A G 11: 113,867,031 M519T probably benign Het
Snx30 A G 4: 59,885,070 S237G probably benign Het
Spx A G 6: 142,414,040 N36S probably damaging Het
Stard7 T C 2: 127,295,496 Y289H probably damaging Het
Sugp2 T C 8: 70,257,107 probably benign Het
Susd4 C T 1: 182,887,478 T288I probably damaging Het
Tceanc2 T A 4: 107,177,629 probably null Het
Tm4sf4 T G 3: 57,433,738 V97G probably benign Het
Tmtc1 C T 6: 148,355,131 probably benign Het
Trappc11 C T 8: 47,505,304 probably benign Het
Triobp G T 15: 78,994,391 V398F possibly damaging Het
Ttll9 T A 2: 152,962,544 S2T possibly damaging Het
Ttn T C 2: 76,900,976 probably benign Het
Tyw3 A G 3: 154,594,471 C80R probably damaging Het
Usp24 T C 4: 106,385,424 V1177A possibly damaging Het
Vmn1r65 A G 7: 6,008,755 V160A probably damaging Het
Vmn2r104 T A 17: 20,041,884 H328L probably benign Het
Vmn2r65 A C 7: 84,940,641 I689S probably damaging Het
Wrn A G 8: 33,241,101 Y1068H probably damaging Het
Xpo4 C A 14: 57,613,409 S346I probably benign Het
Zc3h3 T A 15: 75,839,590 T341S probably benign Het
Zxdc T C 6: 90,370,437 M260T possibly damaging Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGTGCCCTAACCAGTGTC -3'
(R):5'- TGAAGACACAGTCAGCTTCC -3'

Sequencing Primer
(F):5'- GTGCCCTAACCAGTGTCCTGTC -3'
(R):5'- ACAGTCAGCTTCCCTGGGATC -3'
Posted On2016-07-22