Incidental Mutation 'R5339:Adgb'
ID423703
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 042918-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5339 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10442606 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 158 (G158E)
Ref Sequence ENSEMBL: ENSMUSP00000146658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000132573
AA Change: G164E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994
AA Change: G164E

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172530
AA Change: G164E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: G164E

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179956
AA Change: G164E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: G164E

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208717
AA Change: G158E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 C T 3: 148,817,844 R1256H probably benign Het
C3 C A 17: 57,224,308 V329F probably damaging Het
Ccdc50 C T 16: 27,417,305 H130Y probably damaging Het
Chrna7 A G 7: 63,099,307 S476P probably damaging Het
Crtc1 A T 8: 70,397,733 probably benign Het
Dnah12 A G 14: 26,814,537 T2137A possibly damaging Het
Ehd3 G A 17: 73,828,207 M359I possibly damaging Het
Fastkd3 G A 13: 68,590,164 G611R probably damaging Het
Foxa2 T A 2: 148,044,434 S154C probably damaging Het
Gfm2 T C 13: 97,175,040 I733T probably benign Het
Gm1968 T C 16: 29,962,259 noncoding transcript Het
Gmfg-ps T C 6: 4,893,401 noncoding transcript Het
Gzmd A T 14: 56,130,683 N106K possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Ipo5 T C 14: 120,943,710 W883R probably damaging Het
Itpr1 T A 6: 108,393,961 V1063D probably damaging Het
Kansl3 A C 1: 36,367,721 probably benign Het
Klkb1 C A 8: 45,270,711 V556F possibly damaging Het
Krtap14 C A 16: 88,825,859 R77S probably benign Het
Leng8 T A 7: 4,145,286 Y686N possibly damaging Het
Mctp1 C A 13: 76,825,706 probably benign Het
Moxd2 T C 6: 40,885,420 Y155C probably damaging Het
Ofcc1 A G 13: 40,087,845 V729A probably benign Het
Olfr1361 G A 13: 21,659,234 L30F probably benign Het
Olfr728 C A 14: 50,140,302 M112I probably damaging Het
Olfr845 G A 9: 19,339,159 G233E possibly damaging Het
Olfr948 A T 9: 39,319,303 F104I possibly damaging Het
Olfr970 T A 9: 39,819,933 M98K probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Pex5 A T 6: 124,398,004 S629T probably benign Het
Pnpla7 T C 2: 25,002,937 S146P probably benign Het
Prune2 G A 19: 17,120,872 E1247K probably damaging Het
Reg3a A G 6: 78,383,539 probably null Het
Snx8 G A 5: 140,358,150 R78C probably damaging Het
Sstr5 T C 17: 25,491,199 E352G probably benign Het
Svep1 T C 4: 58,121,892 Y767C possibly damaging Het
Tbx15 G A 3: 99,316,284 V263M possibly damaging Het
Tdrd9 T C 12: 112,027,122 Y695H probably damaging Het
Tep1 A T 14: 50,844,574 L1174Q probably damaging Het
Tg T A 15: 66,678,093 Y235N probably damaging Het
Tha1 C A 11: 117,871,082 R111L possibly damaging Het
Trim17 C T 11: 58,954,510 probably null Het
Trim72 A G 7: 128,010,333 T436A probably benign Het
Uba7 C T 9: 107,978,866 A480V probably damaging Het
Ublcp1 A T 11: 44,455,608 S313T probably benign Het
Ubqlnl A G 7: 104,149,765 V175A probably benign Het
Vps26a A G 10: 62,458,967 L276P probably damaging Het
Zdhhc21 C T 4: 82,838,313 G110S probably damaging Het
Zfp236 T C 18: 82,624,366 E1133G probably damaging Het
Zfp800 A T 6: 28,256,473 S39T probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CGGGCTTCTTTTATACGAAGGG -3'
(R):5'- ACTCTGCTAACTCAAAGTCAGTATC -3'

Sequencing Primer
(F):5'- GGGTAAATGAATCCCAATGCC -3'
(R):5'- GCTAACTCAAAGTCAGTATCAAGTC -3'
Posted On2016-08-04