Mutagenetix > Incidental Mutation

Incidental Mutation 'R5350:Adamts16'

423773

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 16

Synonyms

MMRRC Submission

042929-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5350 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70875921-70989930 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 70901315 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 921 (K921*)

Ref Sequence

ENSEMBL: ENSMUSP00000079041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably null
Transcript: ENSMUST00000080145
AA Change: K921*

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: K921*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,210,622 (GRCm39)	Q186*	probably null	Het
Abca9	A	G	11: 110,006,364 (GRCm39)	V1247A	probably benign	Het
Acaca	A	T	11: 84,106,699 (GRCm39)	M133L	probably damaging	Het
Acacb	C	T	5: 114,382,612 (GRCm39)	A2100V	probably damaging	Het
Ankrd55	T	G	13: 112,472,760 (GRCm39)	V144G	probably damaging	Het
Arap3	A	G	18: 38,115,088 (GRCm39)	L976P	probably damaging	Het
Atg2a	T	A	19: 6,301,368 (GRCm39)	V814E	probably damaging	Het
Atp2b2	A	T	6: 113,736,199 (GRCm39)	M960K	probably damaging	Het
Bag1	C	T	4: 40,948,007 (GRCm39)	G66S	possibly damaging	Het
Bmp8a	A	T	4: 123,207,088 (GRCm39)	M391K	probably damaging	Het
Capns1	C	A	7: 29,889,551 (GRCm39)	R216L	probably damaging	Het
Cdk13	T	C	13: 17,978,515 (GRCm39)		probably benign	Het
Cmtm3	T	C	8: 105,070,465 (GRCm39)	F75L	probably damaging	Het
Cops4	T	A	5: 100,666,405 (GRCm39)	D21E	possibly damaging	Het
Dach1	G	T	14: 98,207,395 (GRCm39)	A318E	probably damaging	Het
Ddx27	A	G	2: 166,869,780 (GRCm39)		probably benign	Het
Disp2	A	G	2: 118,618,056 (GRCm39)	T201A	probably benign	Het
Dnah2	G	T	11: 69,406,862 (GRCm39)	D214E	possibly damaging	Het
Dnah7b	G	T	1: 46,272,849 (GRCm39)	G2326C	probably benign	Het
Dusp5	T	C	19: 53,529,665 (GRCm39)	F356S	probably damaging	Het
Duxf3	C	A	10: 58,066,915 (GRCm39)	S528I	probably damaging	Het
Ell	T	A	8: 70,992,439 (GRCm39)	V28E	probably damaging	Het
Evi5	C	T	5: 107,963,544 (GRCm39)	D344N	probably benign	Het
Fv1	G	T	4: 147,954,546 (GRCm39)	V371L	possibly damaging	Het
Gemin5	A	G	11: 58,032,412 (GRCm39)		probably null	Het
Glce	A	T	9: 61,967,587 (GRCm39)	Y521*	probably null	Het
Grn	T	A	11: 102,327,070 (GRCm39)	L556Q	possibly damaging	Het
Icam1	C	A	9: 20,939,182 (GRCm39)	Y518*	probably null	Het
Jag2	A	T	12: 112,872,542 (GRCm39)	S1237R	possibly damaging	Het
Macf1	A	T	4: 123,421,251 (GRCm39)	M1K	probably null	Het
Nbea	T	C	3: 55,926,845 (GRCm39)	E786G	probably damaging	Het
Nr4a2	A	G	2: 57,001,877 (GRCm39)	M192T	probably damaging	Het
Or2v2	T	C	11: 49,003,879 (GRCm39)	T225A	probably benign	Het
Or4a73	T	A	2: 89,421,432 (GRCm39)	E9V	possibly damaging	Het
Or52s1b	T	A	7: 102,822,766 (GRCm39)	H26L	probably damaging	Het
Or7e169	A	T	9: 19,757,912 (GRCm39)	M1K	probably null	Het
Pcnx4	A	C	12: 72,626,138 (GRCm39)	N1115H	probably damaging	Het
Ppargc1b	A	G	18: 61,442,134 (GRCm39)	S585P	possibly damaging	Het
Ppip5k2	C	T	1: 97,648,853 (GRCm39)	S1024N	probably damaging	Het
Prkar1b	C	T	5: 139,092,383 (GRCm39)	E145K	probably damaging	Het
Psd3	T	A	8: 68,361,513 (GRCm39)	T539S	probably benign	Het
Rit2	A	G	18: 31,449,905 (GRCm39)	V31A	probably damaging	Het
Rps6kc1	G	A	1: 190,531,663 (GRCm39)	P780S	probably benign	Het
Serpina6	G	T	12: 103,614,838 (GRCm39)	T336K	possibly damaging	Het
Smo	A	T	6: 29,754,466 (GRCm39)	Q232L	probably benign	Het
Stx2	T	C	5: 129,068,155 (GRCm39)	D184G	probably damaging	Het
Tmprss11d	T	C	5: 86,486,746 (GRCm39)	Y48C	probably benign	Het
Ttn	T	A	2: 76,585,168 (GRCm39)	I22042F	probably damaging	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70,943,603 (GRCm39)	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70,984,234 (GRCm39)	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70,941,260 (GRCm39)	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70,949,080 (GRCm39)	nonsense	probably null
IGL01874:Adamts16	APN	13	70,916,823 (GRCm39)	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70,935,266 (GRCm39)	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70,921,048 (GRCm39)	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70,935,289 (GRCm39)	splice site	probably benign
IGL02450:Adamts16	APN	13	70,984,419 (GRCm39)	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70,886,897 (GRCm39)	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70,901,410 (GRCm39)	missense	probably benign	0.00
swap	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
switcheroo	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70,927,763 (GRCm39)	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70,927,730 (GRCm39)	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70,927,671 (GRCm39)	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70,887,074 (GRCm39)	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70,916,766 (GRCm39)	missense	probably benign
R0524:Adamts16	UTSW	13	70,949,013 (GRCm39)	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0734:Adamts16	UTSW	13	70,886,600 (GRCm39)	splice site	probably benign
R0787:Adamts16	UTSW	13	70,886,948 (GRCm39)	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70,916,811 (GRCm39)	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70,911,680 (GRCm39)	splice site	probably benign
R1027:Adamts16	UTSW	13	70,915,921 (GRCm39)	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70,946,154 (GRCm39)	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70,927,717 (GRCm39)	splice site	probably null
R1869:Adamts16	UTSW	13	70,883,866 (GRCm39)	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70,940,005 (GRCm39)	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70,901,386 (GRCm39)	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70,949,126 (GRCm39)	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70,887,010 (GRCm39)	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70,916,111 (GRCm39)	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70,927,743 (GRCm39)	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R5464:Adamts16	UTSW	13	70,909,868 (GRCm39)	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70,878,253 (GRCm39)	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70,984,494 (GRCm39)	nonsense	probably null
R5735:Adamts16	UTSW	13	70,984,337 (GRCm39)	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70,886,617 (GRCm39)	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70,877,029 (GRCm39)	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70,918,393 (GRCm39)	nonsense	probably null
R6351:Adamts16	UTSW	13	70,984,322 (GRCm39)	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70,927,689 (GRCm39)	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70,877,017 (GRCm39)	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70,916,639 (GRCm39)	splice site	probably null
R6996:Adamts16	UTSW	13	70,946,157 (GRCm39)	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70,921,074 (GRCm39)	nonsense	probably null
R7356:Adamts16	UTSW	13	70,984,399 (GRCm39)	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70,935,283 (GRCm39)	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70,878,234 (GRCm39)	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70,984,265 (GRCm39)	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70,886,701 (GRCm39)	missense	probably benign
R8231:Adamts16	UTSW	13	70,925,599 (GRCm39)	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70,941,217 (GRCm39)	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70,984,496 (GRCm39)	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70,886,794 (GRCm39)	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70,984,453 (GRCm39)	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70,941,307 (GRCm39)	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70,939,910 (GRCm39)	splice site	probably benign
R8973:Adamts16	UTSW	13	70,886,959 (GRCm39)	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70,883,948 (GRCm39)	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70,949,045 (GRCm39)	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70,949,136 (GRCm39)	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70,909,892 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCCAAAGACATTTGTCCTGG -3'
(R):5'- TGTGACACGATAGCTCACAC -3'

Sequencing Primer
(F):5'- AAAGACATTTGTCCTGGTCCTC -3'
(R):5'- CACTCAAAGTGGAGTTTCCTTGACAG -3'

Posted On

2016-08-04