Mutagenetix > Incidental Mutation

Incidental Mutation 'R5464:Adamts16'

433180

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 16

Synonyms

MMRRC Submission

042850-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5464 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70875921-70989930 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70909868 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 895 (H895L)

Ref Sequence

ENSEMBL: ENSMUSP00000105316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably benign
Transcript: ENSMUST00000080145

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109694
AA Change: H895L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: H895L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	2.2e-32	PFAM
Pfam:Reprolysin_5	287	470	1.8e-13	PFAM
Pfam:Reprolysin_4	289	489	7.3e-9	PFAM
Pfam:Reprolysin	289	493	4.6e-33	PFAM
Pfam:Reprolysin_2	306	483	4.1e-10	PFAM
Pfam:Reprolysin_3	310	442	3.3e-10	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,682,227 (GRCm39)	G180E	probably damaging	Het
Acsl1	T	A	8: 46,958,775 (GRCm39)	D95E	probably benign	Het
Acyp2	C	T	11: 30,456,354 (GRCm39)	E98K	possibly damaging	Het
Alox12e	T	C	11: 70,208,505 (GRCm39)	Y483C	probably damaging	Het
Atp13a2	T	A	4: 140,733,381 (GRCm39)	F952I	probably damaging	Het
Crot	T	G	5: 9,033,690 (GRCm39)		probably null	Het
Dnaja1	T	A	4: 40,724,133 (GRCm39)	M98K	probably benign	Het
Eps8	C	T	6: 137,504,473 (GRCm39)	G87R	probably damaging	Het
Flg2	C	A	3: 93,109,277 (GRCm39)	T435K	possibly damaging	Het
Gpatch4	T	C	3: 87,962,062 (GRCm39)		probably null	Het
Heatr1	T	A	13: 12,448,524 (GRCm39)	M1795K	probably benign	Het
Ift52	T	C	2: 162,871,735 (GRCm39)	V189A	probably benign	Het
Kif21a	T	A	15: 90,878,058 (GRCm39)	D250V	probably damaging	Het
Lrrc66	T	C	5: 73,765,622 (GRCm39)	T474A	probably benign	Het
Mcub	T	C	3: 129,709,365 (GRCm39)	E316G	probably benign	Het
Mettl15	C	T	2: 109,021,967 (GRCm39)	V113I	probably benign	Het
Mroh8	T	A	2: 157,063,150 (GRCm39)	I824F	probably damaging	Het
Mrpl19	A	G	6: 81,938,992 (GRCm39)	M270T	probably damaging	Het
Naa12	C	T	18: 80,255,138 (GRCm39)	A144V	probably damaging	Het
Or10d4	A	T	9: 39,581,066 (GRCm39)	T238S	probably damaging	Het
Or4ac1-ps1	T	C	2: 88,370,599 (GRCm39)	Y58C	probably null	Het
Or51a25	A	G	7: 102,373,124 (GRCm39)	V191A	possibly damaging	Het
Or51a39	T	C	7: 102,362,889 (GRCm39)	T244A	probably benign	Het
Or51a43	C	A	7: 103,717,674 (GRCm39)	R188L	possibly damaging	Het
Or51f5	A	G	7: 102,424,640 (GRCm39)	K303R	probably benign	Het
Or52a24	T	A	7: 103,381,396 (GRCm39)	W88R	probably damaging	Het
Or5ak23	AAGTCTGGAGTC	AAGTC	2: 85,245,057 (GRCm39)		probably null	Het
Or6x1	T	C	9: 40,099,080 (GRCm39)	I223T	probably damaging	Het
Pacs1	T	C	19: 5,197,235 (GRCm39)	M430V	probably benign	Het
Piezo2	A	G	18: 63,278,176 (GRCm39)	S243P	probably damaging	Het
Ppp1r36	A	T	12: 76,474,852 (GRCm39)		probably null	Het
Prdm16	T	A	4: 154,430,601 (GRCm39)		probably null	Het
Prss36	A	T	7: 127,533,405 (GRCm39)	W97R	probably damaging	Het
Psmg4	A	T	13: 34,362,047 (GRCm39)	I112F	probably damaging	Het
Ptpru	C	T	4: 131,499,868 (GRCm39)	G1259R	probably damaging	Het
Rsph4a	T	C	10: 33,785,337 (GRCm39)	I416T	possibly damaging	Het
Scn2a	C	T	2: 65,532,100 (GRCm39)	R571C	probably damaging	Het
Selenbp1	A	G	3: 94,851,727 (GRCm39)	M423V	probably benign	Het
Serpina3i	G	A	12: 104,234,751 (GRCm39)	A361T	possibly damaging	Het
Serpinb3c	A	T	1: 107,199,434 (GRCm39)	D362E	probably damaging	Het
Sf3a3	T	C	4: 124,622,033 (GRCm39)		probably null	Het
Sgcg	A	G	14: 61,474,304 (GRCm39)	V113A	possibly damaging	Het
Slc3a2	T	C	19: 8,691,008 (GRCm39)	K74R	probably damaging	Het
Smco1	T	A	16: 32,092,694 (GRCm39)	W122R	probably damaging	Het
Snx19	A	G	9: 30,339,269 (GRCm39)	K136E	possibly damaging	Het
Trim32	A	G	4: 65,532,625 (GRCm39)	N394S	probably damaging	Het
Uqcrb	T	C	13: 67,048,889 (GRCm39)	D87G	probably damaging	Het
Wipf3	T	C	6: 54,462,308 (GRCm39)	S173P	possibly damaging	Het
Zfp473	T	C	7: 44,382,062 (GRCm39)	E756G	probably damaging	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70,943,603 (GRCm39)	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70,984,234 (GRCm39)	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70,941,260 (GRCm39)	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70,949,080 (GRCm39)	nonsense	probably null
IGL01874:Adamts16	APN	13	70,916,823 (GRCm39)	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70,935,266 (GRCm39)	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70,921,048 (GRCm39)	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70,935,289 (GRCm39)	splice site	probably benign
IGL02450:Adamts16	APN	13	70,984,419 (GRCm39)	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70,886,897 (GRCm39)	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70,901,410 (GRCm39)	missense	probably benign	0.00
swap	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
switcheroo	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70,927,763 (GRCm39)	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70,927,730 (GRCm39)	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70,927,671 (GRCm39)	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70,887,074 (GRCm39)	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70,916,766 (GRCm39)	missense	probably benign
R0524:Adamts16	UTSW	13	70,949,013 (GRCm39)	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0734:Adamts16	UTSW	13	70,886,600 (GRCm39)	splice site	probably benign
R0787:Adamts16	UTSW	13	70,886,948 (GRCm39)	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70,916,811 (GRCm39)	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70,911,680 (GRCm39)	splice site	probably benign
R1027:Adamts16	UTSW	13	70,915,921 (GRCm39)	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70,946,154 (GRCm39)	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70,927,717 (GRCm39)	splice site	probably null
R1869:Adamts16	UTSW	13	70,883,866 (GRCm39)	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70,940,005 (GRCm39)	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70,901,386 (GRCm39)	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70,949,126 (GRCm39)	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70,887,010 (GRCm39)	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70,916,111 (GRCm39)	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70,927,743 (GRCm39)	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70,901,315 (GRCm39)	nonsense	probably null
R5613:Adamts16	UTSW	13	70,878,253 (GRCm39)	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70,984,494 (GRCm39)	nonsense	probably null
R5735:Adamts16	UTSW	13	70,984,337 (GRCm39)	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70,886,617 (GRCm39)	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70,877,029 (GRCm39)	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70,918,393 (GRCm39)	nonsense	probably null
R6351:Adamts16	UTSW	13	70,984,322 (GRCm39)	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70,927,689 (GRCm39)	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70,877,017 (GRCm39)	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70,916,639 (GRCm39)	splice site	probably null
R6996:Adamts16	UTSW	13	70,946,157 (GRCm39)	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70,921,074 (GRCm39)	nonsense	probably null
R7356:Adamts16	UTSW	13	70,984,399 (GRCm39)	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70,935,283 (GRCm39)	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70,878,234 (GRCm39)	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70,984,265 (GRCm39)	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70,886,701 (GRCm39)	missense	probably benign
R8231:Adamts16	UTSW	13	70,925,599 (GRCm39)	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70,941,217 (GRCm39)	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70,984,496 (GRCm39)	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70,886,794 (GRCm39)	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70,984,453 (GRCm39)	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70,941,307 (GRCm39)	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70,939,910 (GRCm39)	splice site	probably benign
R8973:Adamts16	UTSW	13	70,886,959 (GRCm39)	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70,883,948 (GRCm39)	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70,949,045 (GRCm39)	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70,949,136 (GRCm39)	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70,909,892 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGTCAATTCAAGGCCTGGC -3'
(R):5'- GATAGATCTTGAATGTTGCCTTCC -3'

Sequencing Primer
(F):5'- CAATTCAAGGCCTGGCAGAGC -3'
(R):5'- CTTTCTTACTGACTTTGCACAGG -3'

Posted On

2016-10-06