Incidental Mutation 'R5415:Nfatc4'
ID427695
Institutional Source Beutler Lab
Gene Symbol Nfatc4
Ensembl Gene ENSMUSG00000023411
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms3110041H08Rik
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55823144-55833943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55832634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 753 (D753G)
Ref Sequence ENSEMBL: ENSMUSP00000154682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024179] [ENSMUST00000172271] [ENSMUST00000226357]
Predicted Effect probably benign
Transcript: ENSMUST00000024179
AA Change: D823G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024179
Gene: ENSMUSG00000023411
AA Change: D823G

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD_DNA_bind 419 578 3.5e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172271
AA Change: D823G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132763
Gene: ENSMUSG00000023411
AA Change: D823G

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD 419 578 3.4e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
low complexity region 878 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226293
Predicted Effect probably benign
Transcript: ENSMUST00000226357
AA Change: D753G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227746
Predicted Effect probably benign
Transcript: ENSMUST00000228308
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear factor of activated T cells (NFAT) protein family. The encoded protein is part of a DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor stimulation and an inducible nuclear component. NFAT proteins are activated by the calmodulin-dependent phosphatase, calcineurin. The encoded protein plays a role in the inducible expression of cytokine genes in T cells, especially in the induction of interleukin-2 and interleukin-4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and exhibit normal embryonic heart morphology as well as normal pathophysiologic cardiac hypertrophy in response to angiotensin II infusion or aortic banding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Ccr1 G T 9: 123,964,376 P39H probably damaging Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Nfatc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Nfatc4 APN 14 55832562 missense probably damaging 1.00
IGL01295:Nfatc4 APN 14 55832505 missense probably benign 0.03
IGL01791:Nfatc4 APN 14 55832238 missense probably null 0.04
IGL02536:Nfatc4 APN 14 55829910 missense probably damaging 1.00
R0448:Nfatc4 UTSW 14 55831654 missense possibly damaging 0.90
R0571:Nfatc4 UTSW 14 55830028 missense probably damaging 0.96
R0743:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0884:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0965:Nfatc4 UTSW 14 55826586 missense probably damaging 1.00
R1141:Nfatc4 UTSW 14 55832631 missense probably damaging 1.00
R2309:Nfatc4 UTSW 14 55827004 missense probably damaging 1.00
R2680:Nfatc4 UTSW 14 55832834 unclassified probably benign
R4200:Nfatc4 UTSW 14 55832032 missense probably damaging 1.00
R4905:Nfatc4 UTSW 14 55830582 missense probably benign 0.16
R5067:Nfatc4 UTSW 14 55832418 missense probably damaging 0.98
R5202:Nfatc4 UTSW 14 55826659 missense probably damaging 1.00
R5585:Nfatc4 UTSW 14 55826755 missense probably damaging 0.98
R5599:Nfatc4 UTSW 14 55832276 missense probably benign 0.02
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6172:Nfatc4 UTSW 14 55829533 missense possibly damaging 0.83
R7292:Nfatc4 UTSW 14 55825055 missense probably damaging 1.00
R7473:Nfatc4 UTSW 14 55831964 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTATAGATCTGGCCTGCGGATG -3'
(R):5'- AACTGATCTCTCGCACTCAC -3'

Sequencing Primer
(F):5'- TGCGGATGTTCCCTGAGAC -3'
(R):5'- TCGCACTCACTTACACTCGCAG -3'
Posted On2016-09-01