Incidental Mutation 'R5415:Ccr1'
ID427688
Institutional Source Beutler Lab
Gene Symbol Ccr1
Ensembl Gene ENSMUSG00000025804
Gene Namechemokine (C-C motif) receptor 1
SynonymsCmkbr1
MMRRC Submission 042984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5415 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123962124-123968692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123964376 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 39 (P39H)
Ref Sequence ENSEMBL: ENSMUSP00000026911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026911]
Predicted Effect probably damaging
Transcript: ENSMUST00000026911
AA Change: P39H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026911
Gene: ENSMUSG00000025804
AA Change: P39H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 316 5.1e-8 PFAM
Pfam:7tm_1 51 301 8.5e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered trafficking and proliferation of myeloid progenitor cells, and impairments in granulomatous inflammation of the lung and neutrophil associated host defense. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,926,065 D260E probably benign Het
A430078G23Rik G A 8: 3,388,075 R303H probably damaging Het
Asb15 A T 6: 24,570,691 Q556L probably benign Het
Cd177 A T 7: 24,752,391 L400Q probably damaging Het
Cideb T C 14: 55,757,855 E58G probably damaging Het
Drd2 A G 9: 49,402,253 K241E possibly damaging Het
Ect2 C T 3: 27,146,853 C126Y probably damaging Het
Eef1d T C 15: 75,903,181 T210A probably benign Het
Enpp2 G A 15: 54,882,156 H315Y probably damaging Het
Ero1lb A T 13: 12,601,767 M362L probably benign Het
Exosc2 A G 2: 31,672,566 K73E possibly damaging Het
Gm9637 T A 14: 19,402,143 noncoding transcript Het
Gstm5 A G 3: 107,897,495 D101G probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kmt2c T C 5: 25,314,701 D2137G probably benign Het
Mecom T C 3: 29,957,526 D619G possibly damaging Het
Met A G 6: 17,527,085 I512V probably benign Het
Myh15 A G 16: 49,117,295 K753R probably null Het
Nfatc4 A G 14: 55,832,634 D753G probably benign Het
Olfr1218 T A 2: 89,054,896 T177S probably benign Het
Olfr1259 T A 2: 89,943,387 T243S probably benign Het
Olfr167 T A 16: 19,515,246 H130L possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 C T 16: 35,943,382 A10V probably damaging Het
Pcdh8 C A 14: 79,770,248 E292* probably null Het
Pdpn A T 4: 143,269,218 V161D probably damaging Het
Peg3 A G 7: 6,708,629 V1198A probably benign Het
Phykpl T C 11: 51,585,515 S21P probably benign Het
Plcb1 G T 2: 135,347,402 V817F possibly damaging Het
Polk T C 13: 96,483,955 Y579C probably benign Het
Ppp1r18 A G 17: 35,867,619 N129D probably benign Het
Psg29 C A 7: 17,211,636 probably null Het
Rims4 C T 2: 163,918,676 R3H probably benign Het
Rnf165 C A 18: 77,466,739 V60L probably damaging Het
Rps6kl1 A T 12: 85,139,381 C292S probably benign Het
Uaca G T 9: 60,870,139 G603C possibly damaging Het
Vmn1r60 T C 7: 5,544,417 H228R probably benign Het
Vmn2r7 T C 3: 64,716,237 T221A probably benign Het
Zfp647 C A 15: 76,911,393 V356L possibly damaging Het
Other mutations in Ccr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ccr1 APN 9 123964053 missense probably benign 0.22
IGL00550:Ccr1 APN 9 123963636 missense probably damaging 1.00
IGL00934:Ccr1 APN 9 123963740 missense probably damaging 0.98
IGL01795:Ccr1 APN 9 123964112 nonsense probably null
IGL02447:Ccr1 APN 9 123963716 missense probably benign 0.01
PIT4431001:Ccr1 UTSW 9 123964194 missense probably benign
PIT4466001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
PIT4472001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
R0900:Ccr1 UTSW 9 123964334 missense possibly damaging 0.50
R0931:Ccr1 UTSW 9 123963790 missense probably damaging 1.00
R1165:Ccr1 UTSW 9 123963494 missense possibly damaging 0.51
R1386:Ccr1 UTSW 9 123963962 missense probably benign 0.05
R1513:Ccr1 UTSW 9 123964473 missense probably benign 0.00
R1615:Ccr1 UTSW 9 123963536 missense probably benign 0.00
R1833:Ccr1 UTSW 9 123964089 missense probably damaging 1.00
R1996:Ccr1 UTSW 9 123963514 missense probably benign 0.41
R3833:Ccr1 UTSW 9 123964287 missense possibly damaging 0.74
R4085:Ccr1 UTSW 9 123963950 missense probably benign
R4545:Ccr1 UTSW 9 123964400 missense probably benign 0.11
R4745:Ccr1 UTSW 9 123963948 missense probably benign 0.05
R5369:Ccr1 UTSW 9 123964289 missense probably damaging 0.98
R5416:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R6446:Ccr1 UTSW 9 123964106 missense probably damaging 0.99
R7179:Ccr1 UTSW 9 123964052 missense probably damaging 1.00
R7423:Ccr1 UTSW 9 123964385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGAGAAGCTTGCACATG -3'
(R):5'- CCCAGGACTCACTGTCTTTAAC -3'

Sequencing Primer
(F):5'- AATCCAGTCGTCTTTCAACTTGTAG -3'
(R):5'- TTCCTCAGCAAAGGATGG -3'
Posted On2016-09-01