Incidental Mutation 'R5484:Tbx4'
ID430325
Institutional Source Beutler Lab
Gene Symbol Tbx4
Ensembl Gene ENSMUSG00000000094
Gene NameT-box 4
Synonyms
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5484 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location85886422-85916097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85914404 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 440 (T440A)
Ref Sequence ENSEMBL: ENSMUSP00000103682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000096] [ENSMUST00000108045] [ENSMUST00000108047]
Predicted Effect probably damaging
Transcript: ENSMUST00000000096
AA Change: T440A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000096
Gene: ENSMUSG00000000094
AA Change: T440A

DomainStartEndE-ValueType
TBOX 71 261 1.15e-126 SMART
Blast:TBOX 302 495 1e-122 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108045
AA Change: T340A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103680
Gene: ENSMUSG00000000094
AA Change: T340A

DomainStartEndE-ValueType
TBOX 1 161 5e-86 SMART
Blast:TBOX 202 395 1e-122 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108047
AA Change: T440A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103682
Gene: ENSMUSG00000000094
AA Change: T440A

DomainStartEndE-ValueType
TBOX 71 261 1.15e-126 SMART
Blast:TBOX 302 495 1e-122 BLAST
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human homolog of mouse Tbx4, which is closely linked to Tbx2 on mouse chromosome 11. Similarly this gene, like TBX2, maps to human chromosome 17. Expression studies in mouse and chicken show that Tbx4 is expressed in developing hindlimb, but not in forelimb buds, suggesting a role for this gene in regulating limb development and specification of limb identity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted, apoptotic allantoises lacking vascular remodeling, fail to undergo chorioallantoic fusion, lack hindlimb buds, and die by embryonic day 10.5. Heterozygotes show mildly impaired allantois growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Tbx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Tbx4 APN 11 85911943 missense probably damaging 1.00
IGL02113:Tbx4 APN 11 85912264 missense possibly damaging 0.82
IGL02172:Tbx4 APN 11 85914563 missense possibly damaging 0.83
IGL02440:Tbx4 APN 11 85890894 missense probably damaging 1.00
IGL02889:Tbx4 APN 11 85899795 nonsense probably null
IGL03380:Tbx4 APN 11 85914639 missense probably benign 0.00
R0332:Tbx4 UTSW 11 85898530 missense probably benign 0.06
R1772:Tbx4 UTSW 11 85911207 missense probably damaging 0.96
R1829:Tbx4 UTSW 11 85911920 intron probably null
R1907:Tbx4 UTSW 11 85914523 missense possibly damaging 0.79
R4470:Tbx4 UTSW 11 85912122 missense probably damaging 0.98
R5540:Tbx4 UTSW 11 85911168 missense possibly damaging 0.94
R6962:Tbx4 UTSW 11 85890259 missense probably benign 0.01
R7355:Tbx4 UTSW 11 85912009 missense probably damaging 1.00
X0027:Tbx4 UTSW 11 85914383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACGATCACTATTTCCGTTC -3'
(R):5'- ACGCTCTCTAGGGAAGGAAG -3'

Sequencing Primer
(F):5'- TCCCTACGACCAGCAGATG -3'
(R):5'- CTCTCTAGGGAAGGAAGCAGAG -3'
Posted On2016-10-05