Incidental Mutation 'R5458:Brca1'
ID432892
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101517285 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1404 (N1404S)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017290
AA Change: N1404S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: N1404S

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGACTAGGTCTAAGGTTCC -3'
(R):5'- TTCGTGGCACATCTCTCAGAG -3'

Sequencing Primer
(F):5'- AGGTCTAAGGTTCCCAAGTTACTCG -3'
(R):5'- GTGGCACATCTCTCAGAGTATATAAC -3'
Posted On2016-10-06