Incidental Mutation 'R5551:Rtn4'
ID435137
Institutional Source Beutler Lab
Gene Symbol Rtn4
Ensembl Gene ENSMUSG00000020458
Gene Namereticulon 4
SynonymsNOGO, C130026I10Rik, NgA, 1110020G17Rik
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29692947-29744331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29741011 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1101 (V1101I)
Ref Sequence ENSEMBL: ENSMUSP00000099907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000060992] [ENSMUST00000078830] [ENSMUST00000102841] [ENSMUST00000102842] [ENSMUST00000102843] [ENSMUST00000170731]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060992
AA Change: V138I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000053754
Gene: ENSMUSG00000020458
AA Change: V138I

DomainStartEndE-ValueType
Pfam:Reticulon 12 182 7.4e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078830
AA Change: V295I

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458
AA Change: V295I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102841
AA Change: V985I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099905
Gene: ENSMUSG00000020458
AA Change: V985I

DomainStartEndE-ValueType
low complexity region 102 110 N/A INTRINSIC
Pfam:Reticulon 859 1029 6.3e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102842
AA Change: V314I

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099906
Gene: ENSMUSG00000020458
AA Change: V314I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 188 358 4.8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102843
AA Change: V1101I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099907
Gene: ENSMUSG00000020458
AA Change: V1101I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
low complexity region 218 226 N/A INTRINSIC
Pfam:Reticulon 975 1139 2.4e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156217
Predicted Effect possibly damaging
Transcript: ENSMUST00000170731
AA Change: V295I

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126413
Gene: ENSMUSG00000020458
AA Change: V295I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the A and B isoforms are viable and one line shows enhanced regeneration and recovery after spinal cord injury. Different lines of mice lacking isoforms A, B, and C show varying phenotypes. Whereas some produce viable homozygotes, others are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Rtn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Rtn4 APN 11 29707291 missense probably damaging 1.00
IGL02187:Rtn4 APN 11 29708291 missense possibly damaging 0.78
IGL02475:Rtn4 APN 11 29733801 missense probably damaging 1.00
IGL02751:Rtn4 APN 11 29706409 critical splice acceptor site probably null
R0063:Rtn4 UTSW 11 29705527 intron probably benign
R0110:Rtn4 UTSW 11 29733849 splice site probably benign
R0510:Rtn4 UTSW 11 29733849 splice site probably benign
R0653:Rtn4 UTSW 11 29707256 missense probably damaging 1.00
R0658:Rtn4 UTSW 11 29706475 missense probably damaging 1.00
R1353:Rtn4 UTSW 11 29707595 missense probably damaging 1.00
R1384:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1873:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1960:Rtn4 UTSW 11 29736464 missense probably damaging 1.00
R1980:Rtn4 UTSW 11 29708634 missense probably benign 0.00
R2319:Rtn4 UTSW 11 29707154 missense probably benign 0.06
R2888:Rtn4 UTSW 11 29693687 missense probably damaging 0.98
R3150:Rtn4 UTSW 11 29693308 small deletion probably benign
R3403:Rtn4 UTSW 11 29707690 missense probably benign 0.12
R3974:Rtn4 UTSW 11 29707505 missense probably damaging 1.00
R3977:Rtn4 UTSW 11 29693819 missense probably benign 0.01
R4223:Rtn4 UTSW 11 29706856 missense probably benign 0.02
R4725:Rtn4 UTSW 11 29708362 missense probably damaging 1.00
R4801:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4802:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4974:Rtn4 UTSW 11 29740994 missense probably damaging 1.00
R4983:Rtn4 UTSW 11 29707217 missense probably benign 0.43
R5292:Rtn4 UTSW 11 29707924 missense probably benign 0.39
R5332:Rtn4 UTSW 11 29733645 missense probably damaging 1.00
R5604:Rtn4 UTSW 11 29708140 missense probably damaging 0.97
R6046:Rtn4 UTSW 11 29708023 missense probably damaging 1.00
R6928:Rtn4 UTSW 11 29706791 missense possibly damaging 0.92
R7386:Rtn4 UTSW 11 29707772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTCTGCTCTATCATGGC -3'
(R):5'- GGAGTAGTCTTCAGGAGCTAAC -3'

Sequencing Primer
(F):5'- AGTGAATCAACTCCCATTTTTGGTC -3'
(R):5'- ACATCTCCCAATCTCACATT -3'
Posted On2016-10-24