Incidental Mutation 'R5551:Dot1l'
ID435135
Institutional Source Beutler Lab
Gene Symbol Dot1l
Ensembl Gene ENSMUSG00000061589
Gene NameDOT1-like, histone H3 methyltransferase (S. cerevisiae)
SynonymsmDot1, KMT4
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5551 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location80755206-80795461 bp(+) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) CCAGCCCCACCCTCAGCC to CCAGCC at 80783628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105336] [ENSMUST00000127740] [ENSMUST00000150338]
Predicted Effect probably benign
Transcript: ENSMUST00000105336
SMART Domains Protein: ENSMUSP00000100973
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 115 317 9.4e-86 PFAM
low complexity region 335 348 N/A INTRINSIC
AT_hook 407 419 4.64e-1 SMART
low complexity region 437 447 N/A INTRINSIC
coiled coil region 558 647 N/A INTRINSIC
low complexity region 917 936 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1145 1157 N/A INTRINSIC
low complexity region 1186 1198 N/A INTRINSIC
low complexity region 1436 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127740
Predicted Effect probably benign
Transcript: ENSMUST00000150338
SMART Domains Protein: ENSMUSP00000116581
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 1 100 3.4e-37 PFAM
low complexity region 118 131 N/A INTRINSIC
AT_hook 190 202 4.64e-1 SMART
low complexity region 220 230 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
SCOP:d1fxkc_ 396 441 1e-3 SMART
low complexity region 700 719 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 969 981 N/A INTRINSIC
low complexity region 1020 1032 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
low complexity region 1060 1105 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163526
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates lysine-79 of histone H3. It is inactive against free core histones, but shows significant histone methyltransferase activity against nucleosomes. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele show late embryonic lethality. Mice homozygous for a null allele die by E10.5 displaying a growth arrest, abnormal yolk sac angiogenesis and heart dilation while mutant ES cells show elevated apoptosis, G2 cell cycle arrest, telomere elongation and aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Dot1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01836:Dot1l APN 10 80785866 missense probably benign 0.00
IGL01915:Dot1l APN 10 80780894 missense probably damaging 0.99
IGL02287:Dot1l APN 10 80764609 missense possibly damaging 0.66
IGL02695:Dot1l APN 10 80777608 missense probably damaging 1.00
IGL03058:Dot1l APN 10 80790997 missense probably benign 0.00
IGL03071:Dot1l APN 10 80788679 missense probably benign 0.00
IGL03120:Dot1l APN 10 80786273 splice site probably benign
R0220:Dot1l UTSW 10 80785858 missense probably damaging 0.99
R1342:Dot1l UTSW 10 80786025 missense probably benign 0.14
R1701:Dot1l UTSW 10 80790742 missense possibly damaging 0.93
R1862:Dot1l UTSW 10 80783539 missense probably damaging 1.00
R2094:Dot1l UTSW 10 80785878 missense probably damaging 1.00
R2308:Dot1l UTSW 10 80789069 missense probably damaging 1.00
R4274:Dot1l UTSW 10 80783988 critical splice donor site probably null
R4617:Dot1l UTSW 10 80785084 missense probably damaging 0.97
R4623:Dot1l UTSW 10 80782150 missense probably benign 0.18
R4690:Dot1l UTSW 10 80786182 nonsense probably null
R5009:Dot1l UTSW 10 80771196 missense probably benign 0.25
R5072:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5073:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5074:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5305:Dot1l UTSW 10 80790793 missense probably benign 0.03
R5312:Dot1l UTSW 10 80784637 missense possibly damaging 0.94
R5512:Dot1l UTSW 10 80788991 missense possibly damaging 0.92
R5552:Dot1l UTSW 10 80783628 small deletion probably benign
R5553:Dot1l UTSW 10 80783628 small deletion probably benign
R6056:Dot1l UTSW 10 80786095 missense probably damaging 0.96
R6207:Dot1l UTSW 10 80786443 missense probably benign 0.06
R6419:Dot1l UTSW 10 80791481 missense possibly damaging 0.85
R6782:Dot1l UTSW 10 80789390 missense probably damaging 1.00
R7054:Dot1l UTSW 10 80787023 missense probably damaging 0.99
R7071:Dot1l UTSW 10 80792245 missense probably benign 0.01
R7097:Dot1l UTSW 10 80790726 missense probably damaging 0.98
R7131:Dot1l UTSW 10 80792341 missense unknown
R7459:Dot1l UTSW 10 80773173 missense probably damaging 0.96
X0066:Dot1l UTSW 10 80788683 missense possibly damaging 0.94
X0066:Dot1l UTSW 10 80788684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGATTCTGGTGCTGAGGAAG -3'
(R):5'- CTACTGTGGGCAACAAACTTG -3'

Sequencing Primer
(F):5'- AAAATCAGGTGTGGCTACTGTC -3'
(R):5'- CTGTGGGCAACAAACTTGTCAAATC -3'
Posted On2016-10-24