Incidental Mutation 'R5664:Mrpl37'
ID444242
Institutional Source Beutler Lab
Gene Symbol Mrpl37
Ensembl Gene ENSMUSG00000028622
Gene Namemitochondrial ribosomal protein L37
Synonyms2300004O14Rik, MRP-L2, Rpml2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location107055874-107066868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107064391 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 214 (N214D)
Ref Sequence ENSEMBL: ENSMUSP00000030365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000030365] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000145324] [ENSMUST00000149453] [ENSMUST00000154283]
Predicted Effect probably benign
Transcript: ENSMUST00000030364
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030365
AA Change: N214D

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030365
Gene: ENSMUSG00000028622
AA Change: N214D

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PDCD9 292 420 6.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106758
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106760
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125397
Predicted Effect probably benign
Transcript: ENSMUST00000126207
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141150
Predicted Effect probably benign
Transcript: ENSMUST00000145324
SMART Domains Protein: ENSMUSP00000122502
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149453
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154283
SMART Domains Protein: ENSMUSP00000119366
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 4.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156406
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Ppl T C 16: 5,106,055 D185G probably benign Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Mrpl37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Mrpl37 APN 4 107060532 missense probably damaging 0.96
IGL02451:Mrpl37 APN 4 107066642 missense probably damaging 1.00
R0088:Mrpl37 UTSW 4 107064424 missense possibly damaging 0.65
R0271:Mrpl37 UTSW 4 107066461 missense possibly damaging 0.80
R1445:Mrpl37 UTSW 4 107064495 missense probably benign 0.00
R2566:Mrpl37 UTSW 4 107064493 missense possibly damaging 0.95
R4751:Mrpl37 UTSW 4 107057475 missense probably damaging 1.00
R5088:Mrpl37 UTSW 4 107064722 missense probably damaging 1.00
R5870:Mrpl37 UTSW 4 107066722 missense probably benign
R5996:Mrpl37 UTSW 4 107066507 missense probably benign
R6163:Mrpl37 UTSW 4 107064596 missense possibly damaging 0.94
X0067:Mrpl37 UTSW 4 107066479 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGATCACAAGTCTGAGGCC -3'
(R):5'- TCCTCCAGATAAGATAACTGAGGAG -3'

Sequencing Primer
(F):5'- GCCTGTGCTATGCAGTGAAG -3'
(R):5'- CCAGATAAGATAACTGAGGAGTGTTG -3'
Posted On2016-11-09