Incidental Mutation 'R5664:Ppl'
ID444295
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Nameperiplakin
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_008909

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5664 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location5086291-5132421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5106055 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 185 (D185G)
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672]
Predicted Effect probably benign
Transcript: ENSMUST00000035672
AA Change: D185G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: D185G

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230554
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,994 probably null Het
1810032O08Rik A T 11: 116,672,664 T27S possibly damaging Het
4930432K21Rik A T 8: 84,166,659 I152F probably benign Het
9430015G10Rik T A 4: 156,123,559 L112H probably damaging Het
Acaca T C 11: 84,243,384 L441P probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arsj A T 3: 126,438,657 I351F probably damaging Het
Atp6v1b2 A G 8: 69,107,620 T373A probably damaging Het
Atr C A 9: 95,905,813 N1486K probably benign Het
Avl9 T C 6: 56,753,839 S583P probably damaging Het
Bptf A T 11: 107,073,699 D1493E probably benign Het
C2cd2l T C 9: 44,313,772 E548G probably damaging Het
Capn3 G A 2: 120,477,025 R15Q probably benign Het
Ccl3 A G 11: 83,649,213 F22S probably benign Het
Clcf1 T C 19: 4,222,096 F69S probably damaging Het
Col13a1 T C 10: 61,851,116 E170G probably damaging Het
Dhx29 T A 13: 112,946,879 F489L probably damaging Het
Dhx8 A T 11: 101,740,751 N390I probably damaging Het
Dkk1 T A 19: 30,548,789 Y135F probably benign Het
Edil3 G T 13: 89,319,713 V446F probably damaging Het
Epha5 T A 5: 84,331,866 E93V probably damaging Het
Epsti1 C T 14: 77,963,664 T196I possibly damaging Het
Fras1 T C 5: 96,728,535 S2376P possibly damaging Het
Frem2 A G 3: 53,652,490 V1532A probably benign Het
Fsip2 T A 2: 82,988,095 M4724K probably benign Het
Gcat T A 15: 79,043,073 L238Q probably damaging Het
Gimap6 T C 6: 48,702,275 K276E probably benign Het
Gjb5 T A 4: 127,355,929 I141F probably benign Het
Glt6d1 T C 2: 25,814,180 I7V probably benign Het
Gm37596 A G 3: 93,692,687 F125S probably benign Het
Gm5771 C T 6: 41,394,671 P17L probably benign Het
Gm6169 C A 13: 97,099,121 L39F probably damaging Het
Gtf2h5 G A 17: 6,084,524 G30R probably damaging Het
Herc6 C A 6: 57,618,684 T449K probably benign Het
Hpn A T 7: 31,099,262 Y132N probably damaging Het
Hpx A T 7: 105,595,148 M190K probably benign Het
Inf2 A G 12: 112,611,728 H1151R unknown Het
Krt74 A G 15: 101,760,579 noncoding transcript Het
Loxl3 G A 6: 83,049,882 S564N probably benign Het
Map7 T A 10: 20,267,359 V418E unknown Het
Mrpl37 T C 4: 107,064,391 N214D probably benign Het
Mthfr T C 4: 148,055,466 Y656H probably damaging Het
Myo9b A G 8: 71,359,882 D2099G probably benign Het
Nktr T A 9: 121,749,417 C825* probably null Het
Nomo1 A G 7: 46,076,157 E1029G probably benign Het
Nup133 T C 8: 123,906,281 D1037G probably benign Het
Olfr1271 A G 2: 90,265,615 F272L probably damaging Het
Olfr153 T C 2: 87,532,834 L267P probably benign Het
Pcdhb14 T A 18: 37,448,996 V385D possibly damaging Het
Pik3c2g T C 6: 139,737,007 L38P probably damaging Het
Pkd1 A T 17: 24,569,371 D701V probably damaging Het
Pnpla6 A G 8: 3,537,478 T1070A probably damaging Het
Prune1 A T 3: 95,258,178 L261Q probably damaging Het
Qser1 A T 2: 104,778,196 L1444I probably damaging Het
Serpina6 A C 12: 103,654,467 C8G probably damaging Het
Sla2 A T 2: 156,874,999 D180E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Tbx3 A G 5: 119,678,731 K311R possibly damaging Het
Thbs2 A T 17: 14,689,837 C167S probably damaging Het
Trak1 T A 9: 121,472,307 C710S possibly damaging Het
Tsks G A 7: 44,953,784 E337K probably damaging Het
Vcpip1 A G 1: 9,746,379 I593T probably damaging Het
Vmn2r118 A G 17: 55,592,765 I713T possibly damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r68 A T 7: 85,233,770 M258K probably benign Het
Vmn2r76 A G 7: 86,245,994 probably null Het
Wap A G 11: 6,638,609 I5T possibly damaging Het
Zfp235 A C 7: 24,142,151 H665P probably damaging Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 5089545 missense probably benign 0.41
IGL00484:Ppl APN 16 5087952 missense probably benign 0.13
IGL00654:Ppl APN 16 5087308 missense possibly damaging 0.94
IGL00832:Ppl APN 16 5088975 missense probably damaging 1.00
IGL01104:Ppl APN 16 5094491 missense probably benign 0.01
IGL01327:Ppl APN 16 5087644 missense probably benign 0.19
IGL01644:Ppl APN 16 5091855 missense probably damaging 1.00
IGL01824:Ppl APN 16 5087889 missense probably damaging 1.00
IGL02071:Ppl APN 16 5113072 missense probably benign 0.04
IGL02085:Ppl APN 16 5089816 missense probably benign 0.09
IGL02282:Ppl APN 16 5101458 missense probably damaging 1.00
IGL02635:Ppl APN 16 5089767 missense probably benign 0.01
IGL02649:Ppl APN 16 5087463 missense probably damaging 1.00
IGL02888:Ppl APN 16 5100407 missense possibly damaging 0.89
IGL03305:Ppl APN 16 5093233 missense possibly damaging 0.62
G4846:Ppl UTSW 16 5087206 missense probably damaging 1.00
IGL03097:Ppl UTSW 16 5096726 missense probably damaging 0.98
R0759:Ppl UTSW 16 5089777 missense probably benign 0.00
R0786:Ppl UTSW 16 5089054 missense probably damaging 1.00
R1024:Ppl UTSW 16 5100000 missense probably damaging 1.00
R1498:Ppl UTSW 16 5104765 missense probably benign 0.05
R1544:Ppl UTSW 16 5102597 nonsense probably null
R1597:Ppl UTSW 16 5107574 missense probably benign 0.20
R1863:Ppl UTSW 16 5087980 missense possibly damaging 0.69
R1921:Ppl UTSW 16 5106124 missense possibly damaging 0.80
R2230:Ppl UTSW 16 5088981 missense possibly damaging 0.51
R2275:Ppl UTSW 16 5094552 missense probably benign 0.00
R2355:Ppl UTSW 16 5094497 missense probably benign 0.00
R3410:Ppl UTSW 16 5107517 missense possibly damaging 0.81
R3737:Ppl UTSW 16 5106857 missense probably benign
R3797:Ppl UTSW 16 5104550 splice site probably benign
R3968:Ppl UTSW 16 5100332 splice site probably null
R3970:Ppl UTSW 16 5100332 splice site probably null
R4034:Ppl UTSW 16 5106857 missense probably benign
R4583:Ppl UTSW 16 5104536 missense probably benign 0.02
R4639:Ppl UTSW 16 5089446 missense probably damaging 1.00
R4762:Ppl UTSW 16 5088982 missense probably benign 0.00
R4828:Ppl UTSW 16 5104926 missense probably damaging 1.00
R4869:Ppl UTSW 16 5104889 missense probably damaging 0.99
R4925:Ppl UTSW 16 5104982 missense probably damaging 1.00
R4983:Ppl UTSW 16 5088718 missense possibly damaging 0.75
R4984:Ppl UTSW 16 5087641 missense probably benign
R4997:Ppl UTSW 16 5089371 missense probably damaging 1.00
R5072:Ppl UTSW 16 5088878 missense probably benign 0.01
R5073:Ppl UTSW 16 5088878 missense probably benign 0.01
R5074:Ppl UTSW 16 5088878 missense probably benign 0.01
R5286:Ppl UTSW 16 5089123 nonsense probably null
R5398:Ppl UTSW 16 5104922 missense probably benign 0.00
R5448:Ppl UTSW 16 5107566 missense probably benign
R5873:Ppl UTSW 16 5106049 critical splice donor site probably null
R5918:Ppl UTSW 16 5104901 missense probably benign 0.00
R5951:Ppl UTSW 16 5088628 missense probably benign 0.25
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6088:Ppl UTSW 16 5104988 missense possibly damaging 0.73
R6149:Ppl UTSW 16 5107596 nonsense probably null
R6358:Ppl UTSW 16 5087929 nonsense probably null
R6379:Ppl UTSW 16 5097691 missense probably benign 0.02
R6468:Ppl UTSW 16 5092441 missense probably damaging 1.00
R6514:Ppl UTSW 16 5087317 missense probably damaging 1.00
R6528:Ppl UTSW 16 5087616 missense probably benign 0.00
R6703:Ppl UTSW 16 5089464 missense probably damaging 0.99
R6721:Ppl UTSW 16 5107469 missense probably damaging 0.97
R6811:Ppl UTSW 16 5089144 missense probably damaging 0.99
R6934:Ppl UTSW 16 5094509 missense probably benign 0.00
X0054:Ppl UTSW 16 5104902 missense probably benign 0.00
Z1088:Ppl UTSW 16 5089507 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCGCCATGATTACACTAGAGCATG -3'
(R):5'- CCATGCTTCCAAGGGTTAGG -3'

Sequencing Primer
(F):5'- GATTACACTAGAGCATGCTGTCC -3'
(R):5'- CCAAGGGTTAGGCTGGGTC -3'
Posted On2016-11-09