Incidental Mutation 'R5753:Vax1'
ID444924
Institutional Source Beutler Lab
Gene Symbol Vax1
Ensembl Gene ENSMUSG00000006270
Gene Nameventral anterior homeobox 1
Synonyms
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R5753 (G1)
Quality Score166
Status Not validated
Chromosome19
Chromosomal Location59166187-59170056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59166382 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 274 (H274Q)
Ref Sequence ENSEMBL: ENSMUSP00000134642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172821]
Predicted Effect probably benign
Transcript: ENSMUST00000172821
AA Change: H274Q

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134642
Gene: ENSMUSG00000006270
AA Change: H274Q

DomainStartEndE-ValueType
HOX 100 162 1.34e-27 SMART
low complexity region 187 206 N/A INTRINSIC
low complexity region 208 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173710
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of the EMX homeobox protein family. The encoded protein functions as a transcription factor which is important in the development of anterior ventral forebrain and visual system. Disruption of this gene causes impairment in the developing forebrain, where the encoded protein is necessary for axon guidance and major tract formation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants exhibit cleft palate and most die at birth. A few survive to 2 weeks of age. Mutants display defects in axon guidance, coloboma, dysgenesis of the optic nerve, defects of basal telencephalon, and holoprosencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Vax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4297:Vax1 UTSW 19 59166251 nonsense probably null
R5897:Vax1 UTSW 19 59169801 missense unknown
R6063:Vax1 UTSW 19 59168604 missense unknown
R6378:Vax1 UTSW 19 59166224 missense probably benign 0.08
R6874:Vax1 UTSW 19 59168523 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGCAGGCGAGTTCATAAATAC -3'
(R):5'- TCCAGAATCGGCGGACTAAG -3'

Sequencing Primer
(F):5'- GGGTAACACTTAAAATCAGTCCAGCG -3'
(R):5'- AAGGACTCGGAGCTGCG -3'
Posted On2016-11-21