Incidental Mutation 'R5755:Jag1'
ID444987
Institutional Source Beutler Lab
Gene Symbol Jag1
Ensembl Gene ENSMUSG00000027276
Gene Namejagged 1
SynonymsABE2, Gsfabe2, Serrate-1, Htu, Ozz, Headturner
MMRRC Submission 043202-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5755 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location137081456-137116644 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137088690 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 674 (N674Y)
Ref Sequence ENSEMBL: ENSMUSP00000028735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028735]
Predicted Effect probably damaging
Transcript: ENSMUST00000028735
AA Change: N674Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028735
Gene: ENSMUSG00000027276
AA Change: N674Y

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:MNNL 31 109 2.8e-31 PFAM
DSL 167 229 1.85e-37 SMART
EGF 233 263 1.66e1 SMART
EGF 264 294 2.25e1 SMART
EGF_CA 296 334 4.42e-7 SMART
EGF 339 372 2.64e-5 SMART
EGF_CA 374 410 2.89e-11 SMART
EGF_CA 412 448 2.8e-9 SMART
EGF_CA 450 485 2.31e-10 SMART
EGF_CA 487 523 1.69e-12 SMART
EGF_CA 525 561 4.19e-8 SMART
EGF 577 627 2.16e-1 SMART
EGF_CA 629 665 2.56e-12 SMART
EGF_CA 667 703 6.91e-9 SMART
EGF 708 741 5.88e-3 SMART
EGF 747 780 9.62e-8 SMART
EGF_CA 782 818 3.59e-7 SMART
EGF_CA 820 856 3.81e-11 SMART
VWC 863 930 4.79e-16 SMART
transmembrane domain 1069 1091 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133640
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit extensive hemorrhaging and die prior to embryonic day 11.5, while heterozygotes exhibit defects of the eye. Heterozygotes for missense mutations have inner ear abnormalities. Other mutant mice display abnormal head movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,398,454 F1042I probably damaging Het
Ahnak A G 19: 9,001,732 T127A probably benign Het
Aloxe3 A G 11: 69,132,749 I233V probably benign Het
Ambn T A 5: 88,464,491 probably null Het
Atp2b1 T C 10: 98,994,809 probably null Het
Atp2b1 A G 10: 99,003,170 E39G probably damaging Het
Camsap2 C T 1: 136,282,327 G476R probably damaging Het
Ccdc144b A T 3: 36,017,693 M501K probably benign Het
Cdk4 T A 10: 127,064,722 probably null Het
Dcaf12 T C 4: 41,313,356 Y63C probably damaging Het
Dtna T A 18: 23,621,463 S445T probably benign Het
Ehmt2 T C 17: 34,908,238 M109T probably benign Het
Erbb4 T C 1: 68,560,519 E133G possibly damaging Het
F830016B08Rik T A 18: 60,300,806 F320L probably damaging Het
Fyco1 A G 9: 123,828,708 V801A possibly damaging Het
Kcnj10 A G 1: 172,369,594 E225G possibly damaging Het
Klhl11 T A 11: 100,464,351 M215L probably benign Het
Kmt2d G T 15: 98,863,646 P608T unknown Het
Map3k19 T C 1: 127,822,381 M1078V probably benign Het
Neto1 T C 18: 86,499,094 V512A probably damaging Het
Notch1 T C 2: 26,473,692 D910G probably benign Het
Olfr263 T A 13: 21,133,525 I250K probably damaging Het
Olfr378 T A 11: 73,425,731 N84I probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Pi4kb A T 3: 94,994,297 probably null Het
Plag1 T C 4: 3,904,492 K233R possibly damaging Het
Rasgrp3 A C 17: 75,524,945 D587A probably benign Het
Slc7a10 A T 7: 35,198,911 I336F probably damaging Het
Snx8 T G 5: 140,353,041 E254A possibly damaging Het
Sp3 A T 2: 72,938,381 silent Het
Sp8 G T 12: 118,849,087 A226S probably damaging Het
Spata31d1c C A 13: 65,036,527 Q628K probably benign Het
Styx C A 14: 45,368,453 T138K probably benign Het
Syngr3 A G 17: 24,686,535 F155S probably damaging Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Ubr4 A G 4: 139,460,095 T3825A possibly damaging Het
Vmn2r113 A T 17: 22,957,981 T580S probably benign Het
Zbtb11 T A 16: 56,000,713 S724R probably benign Het
Zcchc4 T C 5: 52,816,169 S379P probably benign Het
Znrd1 T A 17: 36,958,157 D43V probably benign Het
Other mutations in Jag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Jag1 APN 2 137086032 critical splice acceptor site probably null
IGL00912:Jag1 APN 2 137115573 missense probably damaging 1.00
IGL01104:Jag1 APN 2 137084378 missense probably benign 0.40
IGL01529:Jag1 APN 2 137084977 missense probably damaging 0.99
IGL01578:Jag1 APN 2 137100051 splice site probably benign
IGL01720:Jag1 APN 2 137087103 missense probably damaging 1.00
IGL01809:Jag1 APN 2 137115484 missense probably damaging 1.00
IGL02402:Jag1 APN 2 137085938 missense possibly damaging 0.79
IGL02434:Jag1 APN 2 137087155 missense probably benign 0.01
IGL02543:Jag1 APN 2 137091947 splice site probably benign
IGL02650:Jag1 APN 2 137115585 missense possibly damaging 0.95
IGL03010:Jag1 APN 2 137093198 splice site probably benign
IGL03102:Jag1 APN 2 137084688 missense probably benign 0.00
Grenville UTSW 2 137087142 missense probably damaging 1.00
PIT4651001:Jag1 UTSW 2 137101697 missense probably damaging 1.00
R0227:Jag1 UTSW 2 137115618 missense probably benign
R0306:Jag1 UTSW 2 137085935 missense probably damaging 1.00
R0325:Jag1 UTSW 2 137095445 critical splice donor site probably null
R0594:Jag1 UTSW 2 137087080 missense probably damaging 0.99
R0838:Jag1 UTSW 2 137093278 missense probably damaging 0.98
R0879:Jag1 UTSW 2 137100081 missense possibly damaging 0.80
R0900:Jag1 UTSW 2 137090882 frame shift probably null
R0972:Jag1 UTSW 2 137083451 missense possibly damaging 0.64
R1083:Jag1 UTSW 2 137096232 missense probably damaging 0.99
R1182:Jag1 UTSW 2 137091489 missense probably benign 0.36
R1292:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1500:Jag1 UTSW 2 137115638 missense possibly damaging 0.82
R1936:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1937:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1939:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1998:Jag1 UTSW 2 137090938 missense probably damaging 1.00
R2019:Jag1 UTSW 2 137084679 missense probably benign 0.37
R2213:Jag1 UTSW 2 137089892 missense probably benign 0.01
R2300:Jag1 UTSW 2 137096315 missense probably damaging 1.00
R2484:Jag1 UTSW 2 137084700 missense possibly damaging 0.86
R4179:Jag1 UTSW 2 137101658 missense probably damaging 0.99
R4212:Jag1 UTSW 2 137085070 missense probably benign
R4630:Jag1 UTSW 2 137085979 missense probably damaging 1.00
R4701:Jag1 UTSW 2 137094456 missense probably benign 0.11
R4705:Jag1 UTSW 2 137096309 missense probably damaging 1.00
R4904:Jag1 UTSW 2 137087142 missense probably damaging 1.00
R5050:Jag1 UTSW 2 137085154 missense possibly damaging 0.71
R5288:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5367:Jag1 UTSW 2 137085094 missense possibly damaging 0.90
R5385:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5386:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5430:Jag1 UTSW 2 137101706 missense possibly damaging 0.94
R5472:Jag1 UTSW 2 137084995 missense probably damaging 1.00
R5764:Jag1 UTSW 2 137089247 missense probably damaging 1.00
R5804:Jag1 UTSW 2 137088204 missense probably benign 0.01
R6406:Jag1 UTSW 2 137087643 missense probably damaging 1.00
R6503:Jag1 UTSW 2 137101629 missense probably damaging 1.00
R6721:Jag1 UTSW 2 137094474 missense probably benign 0.00
R6826:Jag1 UTSW 2 137116175 critical splice donor site probably null
R7055:Jag1 UTSW 2 137115489 missense probably benign 0.26
R7214:Jag1 UTSW 2 137106882 missense probably benign 0.00
Z1088:Jag1 UTSW 2 137085151 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACCATTATTACACGTGGCTTCG -3'
(R):5'- GCCGAGAACTTGTCTAAAAGGTTG -3'

Sequencing Primer
(F):5'- TCACACTGGCTGTCACCTGAAG -3'
(R):5'- TGATGATGAAGTTGAGGTCCTAGGAC -3'
Posted On2016-11-21