Incidental Mutation 'R5759:Olfr862'
ID445193
Institutional Source Beutler Lab
Gene Symbol Olfr862
Ensembl Gene ENSMUSG00000063842
Gene Nameolfactory receptor 862
SynonymsGA_x6K02T2PVTD-13624132-13623212, MOR146-1
MMRRC Submission 043361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5759 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19882417-19888004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19884188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 39 (V39A)
Ref Sequence ENSEMBL: ENSMUSP00000078603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073765] [ENSMUST00000079660]
Predicted Effect probably benign
Transcript: ENSMUST00000073765
AA Change: V39A

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073437
Gene: ENSMUSG00000063842
AA Change: V39A

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:7tm_4 31 306 3.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 282 1.3e-7 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079660
AA Change: V39A

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078603
Gene: ENSMUSG00000063842
AA Change: V39A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 8.3e-8 PFAM
Pfam:7tm_1 41 290 4.5e-22 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,658 S1203P probably benign Het
Adamts1 A G 16: 85,798,048 V341A possibly damaging Het
AF529169 A T 9: 89,601,072 N757K probably benign Het
Arf2 G A 11: 103,983,633 G144S probably benign Het
Atr A G 9: 95,874,402 N862D probably benign Het
Cep295nl T C 11: 118,333,646 H124R possibly damaging Het
Chd6 C T 2: 160,983,762 V1141I possibly damaging Het
Chst5 C A 8: 111,890,210 K259N probably benign Het
Dchs1 T A 7: 105,764,176 D1144V probably damaging Het
Dmxl2 T C 9: 54,375,508 Y2795C probably damaging Het
Dnah7b A G 1: 46,277,120 N3131S probably damaging Het
Dnah7c G A 1: 46,615,367 G1436R probably damaging Het
Emp2 T A 16: 10,284,510 Y146F probably damaging Het
Exoc6 C T 19: 37,573,741 Q148* probably null Het
Fam13b T C 18: 34,497,435 D90G probably damaging Het
Fam186b T G 15: 99,279,717 Y576S probably benign Het
Fras1 T C 5: 96,709,916 V2023A probably benign Het
Gm14409 A T 2: 177,264,972 C244* probably null Het
Grm5 A C 7: 88,026,600 M441L probably damaging Het
Hhatl A G 9: 121,788,277 Y297H probably damaging Het
Ifi30 A G 8: 70,766,544 probably benign Het
Ing2 G T 8: 47,669,005 N169K possibly damaging Het
Kat6a T G 8: 22,938,012 S1128A probably benign Het
Madd T C 2: 91,162,075 E1041G possibly damaging Het
Mcm3 CT CTT 1: 20,808,748 probably null Het
Mfsd5 G A 15: 102,281,078 G295D possibly damaging Het
Mmp20 T A 9: 7,628,377 probably null Het
Mybphl T C 3: 108,374,754 V100A probably benign Het
Ndfip2 T A 14: 105,302,316 probably null Het
Olfr869 T A 9: 20,137,932 V272E probably benign Het
Olfr905 T A 9: 38,473,535 S263T possibly damaging Het
Phf19 T G 2: 34,897,123 D443A probably damaging Het
Piezo1 A G 8: 122,507,655 V84A probably damaging Het
Sept9 A G 11: 117,352,268 I94V probably benign Het
Slc35a1 C A 4: 34,675,032 V132L probably benign Het
Sntg1 G A 1: 8,414,270 S442L probably benign Het
Tcf25 A G 8: 123,381,457 T84A probably benign Het
Tchhl1 C G 3: 93,471,556 S522R probably damaging Het
Tmem106b A G 6: 13,075,042 E76G probably damaging Het
Tnk2 C T 16: 32,680,664 P932S probably benign Het
Trib1 G A 15: 59,654,501 V307I probably benign Het
Trib3 A T 2: 152,343,295 D11E probably benign Het
Trim34b T C 7: 104,331,433 S243P possibly damaging Het
Vmn2r50 A G 7: 10,047,978 I280T probably damaging Het
Zfp445 G T 9: 122,853,146 Q577K probably benign Het
Zfp599 T C 9: 22,249,661 K403E probably damaging Het
Other mutations in Olfr862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr862 APN 9 19883548 nonsense probably null
IGL01636:Olfr862 APN 9 19884188 missense probably benign 0.14
IGL01765:Olfr862 APN 9 19883951 missense possibly damaging 0.71
IGL01967:Olfr862 APN 9 19883589 missense probably damaging 0.97
IGL03145:Olfr862 APN 9 19883439 missense possibly damaging 0.93
IGL03222:Olfr862 APN 9 19884199 nonsense probably null
R0117:Olfr862 UTSW 9 19884299 missense probably damaging 0.96
R0662:Olfr862 UTSW 9 19883952 missense probably benign 0.32
R2399:Olfr862 UTSW 9 19883924 missense probably damaging 0.98
R4224:Olfr862 UTSW 9 19883600 missense probably benign 0.44
R4572:Olfr862 UTSW 9 19883979 missense probably benign
R5607:Olfr862 UTSW 9 19883976 missense probably benign 0.16
R5741:Olfr862 UTSW 9 19883561 missense possibly damaging 0.92
R6237:Olfr862 UTSW 9 19884069 missense probably damaging 1.00
R6434:Olfr862 UTSW 9 19883845 nonsense probably null
R7075:Olfr862 UTSW 9 19884063 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGTAGGCTGTCCATACACCC -3'
(R):5'- ACCAGTTACCTCTACAGTGCTTAATTC -3'

Sequencing Primer
(F):5'- CTGAGTTAGGCAGGCTGC -3'
(R):5'- TACCTCTACAGTGCTTAATTCAACAC -3'
Posted On2016-11-21