Incidental Mutation 'R0544:Lrp2'
ID44648
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Namelow density lipoprotein receptor-related protein 2
SynonymsGp330, D230004K18Rik, b2b1625.2Clo, Megalin
MMRRC Submission 038736-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0544 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69424340-69586065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69491931 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1885 (K1885E)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
Predicted Effect probably benign
Transcript: ENSMUST00000080953
AA Change: K1885E

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: K1885E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,157,314 F130L probably benign Het
Aatf C T 11: 84,423,005 R511Q probably benign Het
Acot12 A T 13: 91,784,656 D516V probably benign Het
Adgrb2 T C 4: 130,017,542 V1207A probably damaging Het
Akap9 A G 5: 4,069,185 D3564G probably benign Het
Arl8b C T 6: 108,783,228 probably benign Het
Atf6b T C 17: 34,648,299 probably null Het
Atrn G A 2: 130,986,826 G1097D probably damaging Het
Btbd6 A G 12: 112,977,082 E61G probably damaging Het
Car15 A G 16: 17,835,816 probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Carmil2 C T 8: 105,691,235 A654V probably damaging Het
Cbwd1 A G 19: 24,949,211 Y159H possibly damaging Het
Ccdc88b A G 19: 6,857,266 L124P probably damaging Het
Ccnd1 A G 7: 144,937,286 probably benign Het
Cd3eap G T 7: 19,359,141 P38Q probably damaging Het
Cenph A G 13: 100,772,741 S53P probably damaging Het
Chrm3 T A 13: 9,877,579 I474F probably damaging Het
Cln8 T A 8: 14,896,769 V261E probably benign Het
Coa6 A G 8: 126,422,760 D25G probably benign Het
Col4a1 T G 8: 11,226,487 probably benign Het
Cpxm1 T C 2: 130,393,135 H588R probably damaging Het
Cul7 T C 17: 46,663,544 L1516P possibly damaging Het
Dcdc5 A G 2: 106,351,564 noncoding transcript Het
Ddx5 T C 11: 106,782,462 probably benign Het
Dhx16 C A 17: 35,881,659 P161Q probably benign Het
Dpy19l1 A T 9: 24,485,110 probably benign Het
Fastkd5 A G 2: 130,615,296 V458A probably damaging Het
Fhit A G 14: 9,870,172 V99A probably damaging Het
Fndc3a A T 14: 72,557,622 probably benign Het
Foxd4 A T 19: 24,899,818 S339R possibly damaging Het
Gm10842 T A 11: 105,147,054 D54E unknown Het
Gns T A 10: 121,376,267 Y94* probably null Het
Gp2 A G 7: 119,454,496 W81R probably benign Het
Hdac5 T G 11: 102,196,096 Q46P probably damaging Het
Homer2 A C 7: 81,649,678 V13G probably damaging Het
Irs3 A G 5: 137,643,839 S446P probably benign Het
Ism2 G T 12: 87,285,339 D141E probably damaging Het
Jak1 T A 4: 101,191,625 M19L probably benign Het
Kcnd3 C A 3: 105,658,759 R419S probably damaging Het
Lamb1 T C 12: 31,282,695 F272S probably damaging Het
Ldlrad2 T G 4: 137,572,268 T82P possibly damaging Het
Mbd5 T C 2: 49,257,209 V477A possibly damaging Het
Mrps33 A T 6: 39,805,554 M11K possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myom2 T A 8: 15,069,796 V184E probably damaging Het
Ncor1 C A 11: 62,333,776 G1210V probably damaging Het
Ncor1 C T 11: 62,333,777 G1210R probably damaging Het
Nlrp4a A G 7: 26,457,130 D760G probably benign Het
Noc4l A G 5: 110,651,123 V231A possibly damaging Het
Olfr1056 T C 2: 86,355,663 T240A probably damaging Het
Olfr1217 T C 2: 89,023,826 Y59C probably damaging Het
Olfr1306 A T 2: 111,912,560 Y123* probably null Het
Olfr1450 A G 19: 12,953,702 T38A possibly damaging Het
Olfr193 T A 16: 59,110,225 K128N probably benign Het
Olfr521 T C 7: 99,767,660 I166T probably benign Het
Olfr598 T A 7: 103,328,651 I55N probably damaging Het
Olfr733 A T 14: 50,298,682 V209E probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Patj T A 4: 98,569,110 M1283K probably damaging Het
Pkd1 C T 17: 24,585,683 T790I probably damaging Het
Plod3 C A 5: 136,991,611 T526K probably benign Het
Plxnb2 C A 15: 89,158,613 probably benign Het
Pramel1 T A 4: 143,397,605 D283E possibly damaging Het
Prpf40a T C 2: 53,141,651 probably benign Het
Psg23 A T 7: 18,614,682 Y67N probably damaging Het
Rftn1 T A 17: 49,994,261 Q242L possibly damaging Het
Rp1l1 A T 14: 64,032,066 E1700D probably benign Het
Scube3 T C 17: 28,164,153 F435S probably damaging Het
Sdk2 T C 11: 113,781,010 Y2104C probably damaging Het
Sept11 A G 5: 93,165,368 E358G possibly damaging Het
Sh3bp1 T C 15: 78,905,775 L246P probably damaging Het
Sis T C 3: 72,951,642 Y352C probably damaging Het
Skint1 T C 4: 112,021,365 S165P probably damaging Het
Skint10 C T 4: 112,728,811 probably benign Het
Slc1a2 A T 2: 102,756,072 R340S probably damaging Het
Slc26a3 C A 12: 31,447,740 Q48K probably benign Het
Slc5a2 A T 7: 128,269,999 Y317F probably damaging Het
Sorbs3 T A 14: 70,193,926 T262S probably benign Het
Tas2r118 G T 6: 23,969,401 S220R probably damaging Het
Terf2ip C A 8: 112,015,342 Q223K possibly damaging Het
Tespa1 A G 10: 130,360,811 Q206R probably damaging Het
Tex10 T C 4: 48,462,766 probably null Het
Tle1 T A 4: 72,124,990 K547N probably damaging Het
Tmem131l T A 3: 83,898,546 Q1530L probably damaging Het
Tomm20l A G 12: 71,123,077 E145G possibly damaging Het
Tra2a C T 6: 49,250,951 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim37 T A 11: 87,145,502 Y121* probably null Het
Tube1 C T 10: 39,140,945 probably null Het
Usp6nl T A 2: 6,421,009 V187D probably damaging Het
Vmn1r13 T C 6: 57,210,263 F136L probably benign Het
Vmn1r201 A T 13: 22,475,146 I177F probably benign Het
Vmn1r203 A T 13: 22,524,273 T75S possibly damaging Het
Vmn1r225 C T 17: 20,502,456 S53L probably benign Het
Xab2 A T 8: 3,610,994 W707R probably damaging Het
Zfp808 T C 13: 62,169,434 probably benign Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69507779 missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69486280 missense probably benign 0.00
IGL00782:Lrp2 APN 2 69501645 missense probably benign 0.14
IGL00821:Lrp2 APN 2 69459516 missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69521881 missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69469436 missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69524073 missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69492432 nonsense probably null
IGL01131:Lrp2 APN 2 69499239 missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69510984 missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69503526 missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69552470 splice site probably benign
IGL01375:Lrp2 APN 2 69478566 splice site probably benign
IGL01384:Lrp2 APN 2 69483502 missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69453812 missense probably null 1.00
IGL01411:Lrp2 APN 2 69482267 missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69525286 missense probably benign
IGL01444:Lrp2 APN 2 69443716 missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69472439 missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69492460 missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69428706 missense probably benign
IGL01761:Lrp2 APN 2 69481235 missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69486184 missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69483601 missense probably benign 0.08
IGL02015:Lrp2 APN 2 69527578 missense probably benign 0.00
IGL02104:Lrp2 APN 2 69510418 missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69537616 missense probably benign 0.01
IGL02134:Lrp2 APN 2 69513379 critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69466880 missense probably benign 0.01
IGL02212:Lrp2 APN 2 69451264 missense probably benign 0.00
IGL02240:Lrp2 APN 2 69535046 missense probably benign
IGL02248:Lrp2 APN 2 69482808 missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69464636 missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69469633 missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69461305 missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69521773 missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69464801 splice site probably benign
IGL02508:Lrp2 APN 2 69503430 missense probably benign 0.04
IGL02751:Lrp2 APN 2 69533462 missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69506736 missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69455510 missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69487837 missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69455453 splice site probably benign
IGL02990:Lrp2 APN 2 69441396 missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69537553 missense probably benign 0.43
IGL03038:Lrp2 APN 2 69475464 missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69483133 missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69454833 missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69477026 missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69549042 missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69455452 splice site probably benign
IGL03163:Lrp2 APN 2 69501526 nonsense probably null
IGL03164:Lrp2 APN 2 69464699 missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69523194 missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69466265 missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69438478 splice site probably benign
IGL03288:Lrp2 APN 2 69426039 missense probably benign 0.02
IGL03350:Lrp2 APN 2 69438453 missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69431152 missense probably damaging 1.00
casual UTSW 2 69499263 missense probably benign
relaxed UTSW 2 69535005 missense probably damaging 1.00
unintended UTSW 2 69518443 missense probably damaging 1.00
IGL02835:Lrp2 UTSW 2 69505304 missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69458448 missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69537538 missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69475403 missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0044:Lrp2 UTSW 2 69527555 missense probably benign 0.01
R0044:Lrp2 UTSW 2 69527555 missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69465627 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69477040 missense probably benign
R0167:Lrp2 UTSW 2 69425658 missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69537563 missense probably null 1.00
R0243:Lrp2 UTSW 2 69428630 missense probably benign 0.00
R0308:Lrp2 UTSW 2 69482982 splice site probably benign
R0323:Lrp2 UTSW 2 69469639 missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69535043 missense probably benign 0.10
R0374:Lrp2 UTSW 2 69430307 missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69456858 missense probably damaging 0.99
R0391:Lrp2 UTSW 2 69460337 splice site probably benign
R0395:Lrp2 UTSW 2 69433077 missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69479148 missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69525234 missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69507801 missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69511017 missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69428654 missense probably benign 0.00
R0548:Lrp2 UTSW 2 69537638 splice site probably benign
R0593:Lrp2 UTSW 2 69467006 missense probably benign
R0608:Lrp2 UTSW 2 69486243 missense probably benign 0.02
R0633:Lrp2 UTSW 2 69448120 missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69451380 missense probably benign 0.19
R0718:Lrp2 UTSW 2 69510948 missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69448169 missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69507990 missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69518365 missense probably benign 0.32
R0885:Lrp2 UTSW 2 69482353 missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69487838 missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69524036 missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69523302 unclassified probably null
R1301:Lrp2 UTSW 2 69428604 missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69456918 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69460477 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69483394 missense probably damaging 0.99
R1529:Lrp2 UTSW 2 69523182 missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69500730 missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69502610 missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69502661 missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69466763 critical splice donor site probably null
R1689:Lrp2 UTSW 2 69503529 missense probably benign 0.09
R1693:Lrp2 UTSW 2 69510418 missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69496489 missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69503530 missense probably benign 0.04
R1834:Lrp2 UTSW 2 69466880 missense probably benign 0.01
R1921:Lrp2 UTSW 2 69523287 missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69467090 missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69507843 missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2093:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2108:Lrp2 UTSW 2 69506624 missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69483385 missense probably benign 0.05
R2122:Lrp2 UTSW 2 69483707 missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69511067 missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69467028 missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69511010 missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69491847 missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69506374 splice site probably null
R2984:Lrp2 UTSW 2 69425814 splice site probably null
R3085:Lrp2 UTSW 2 69467135 missense probably benign 0.05
R3103:Lrp2 UTSW 2 69431984 missense probably benign 0.00
R3727:Lrp2 UTSW 2 69510429 missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3731:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3764:Lrp2 UTSW 2 69496336 missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69505105 missense probably benign 0.34
R3778:Lrp2 UTSW 2 69509204 missense probably benign 0.00
R3808:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69426012 missense probably benign 0.03
R3852:Lrp2 UTSW 2 69537565 missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69459472 critical splice donor site probably null
R3877:Lrp2 UTSW 2 69549047 missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69506376 missense probably benign
R4081:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69430262 critical splice donor site probably null
R4193:Lrp2 UTSW 2 69467143 missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69480094 missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69425991 nonsense probably null
R4352:Lrp2 UTSW 2 69432182 critical splice donor site probably null
R4407:Lrp2 UTSW 2 69502517 missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69467169 missense probably benign 0.09
R4416:Lrp2 UTSW 2 69527231 missense probably benign 0.18
R4426:Lrp2 UTSW 2 69506348 missense probably benign 0.00
R4510:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69513285 missense probably benign 0.13
R4591:Lrp2 UTSW 2 69536075 missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69458427 nonsense probably null
R4622:Lrp2 UTSW 2 69460349 missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69489129 splice site probably null
R4633:Lrp2 UTSW 2 69461417 missense probably benign 0.16
R4636:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69466993 missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69489298 missense probably benign 0.02
R4712:Lrp2 UTSW 2 69506551 missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69487966 missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69481173 missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69533555 missense probably benign
R4733:Lrp2 UTSW 2 69533555 missense probably benign
R4777:Lrp2 UTSW 2 69482264 missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69459715 missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69537956 missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69469411 missense probably benign 0.06
R4845:Lrp2 UTSW 2 69509241 missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69479113 missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69472368 missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69535988 missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69481388 missense probably benign 0.01
R5075:Lrp2 UTSW 2 69465758 missense probably benign 0.00
R5078:Lrp2 UTSW 2 69501530 missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69489158 missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69501490 missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69430342 missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69552349 splice site probably null
R5223:Lrp2 UTSW 2 69524053 missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69456819 splice site probably null
R5267:Lrp2 UTSW 2 69548978 missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69513354 missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69525228 missense probably benign 0.01
R5355:Lrp2 UTSW 2 69454838 nonsense probably null
R5356:Lrp2 UTSW 2 69464708 missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69459560 missense probably benign 0.04
R5486:Lrp2 UTSW 2 69437465 missense probably benign 0.04
R5554:Lrp2 UTSW 2 69552424 missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69451288 missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69464624 missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69499263 missense probably benign
R5605:Lrp2 UTSW 2 69523299 missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69472418 missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69519914 missense probably null 0.80
R5686:Lrp2 UTSW 2 69511061 missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69502553 missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69451382 missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69509147 missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69466877 missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69455525 missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69480153 missense probably benign 0.00
R5892:Lrp2 UTSW 2 69442776 missense probably benign
R5951:Lrp2 UTSW 2 69496323 splice site probably null
R5974:Lrp2 UTSW 2 69459548 missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69535005 missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69506754 missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69483557 missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69511001 missense probably benign 0.00
R6177:Lrp2 UTSW 2 69510419 frame shift probably null
R6180:Lrp2 UTSW 2 69503524 missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69469478 missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69466340 missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69436681 missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69438467 missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69483443 missense probably benign 0.02
R6385:Lrp2 UTSW 2 69495784 missense probably benign 0.22
R6429:Lrp2 UTSW 2 69461287 missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69505156 missense probably benign 0.00
R6524:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69509303 missense probably benign 0.00
R6594:Lrp2 UTSW 2 69439923 missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69469405 missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69453858 missense probably benign 0.01
R6718:Lrp2 UTSW 2 69483780 missense probably benign 0.09
R6736:Lrp2 UTSW 2 69448211 missense probably benign 0.02
R6738:Lrp2 UTSW 2 69458488 missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69483904 missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69518443 missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69513268 missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69513377 missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69524141 missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69510502 missense probably benign
R6902:Lrp2 UTSW 2 69459503 missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69472365 missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69489305 missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69472455 missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69483208 missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69483028 missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69521787 missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69465745 missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69454808 critical splice donor site probably null
R7150:Lrp2 UTSW 2 69488051 missense probably damaging 0.99
X0011:Lrp2 UTSW 2 69519998 missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69436600 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGAAAACTAAAGCCGCTCGTACC -3'
(R):5'- TGACAGTACGTTCCTGTCTGCACC -3'

Sequencing Primer
(F):5'- GTACCACGCCTCTGCTG -3'
(R):5'- GTCACTGTGAAGATCGGTAACTC -3'
Posted On2013-06-11