Incidental Mutation 'R5789:Cp'
ID448193
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
SynonymsD3Ertd555e
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19957290 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 3 (F3I)
Ref Sequence ENSEMBL: ENSMUSP00000103965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
Predicted Effect probably benign
Transcript: ENSMUST00000003714
AA Change: F3I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: F3I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091309
AA Change: F3I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: F3I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108325
AA Change: F3I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: F3I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108328
AA Change: F3I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: F3I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108329
AA Change: F3I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: F3I

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1733:Cp UTSW 3 19968219 splice site probably benign
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1816:Cp UTSW 3 19968220 splice site probably benign
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R2249:Cp UTSW 3 19987570 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4724:Cp UTSW 3 19972647 missense probably benign 0.02
R4910:Cp UTSW 3 19989224 unclassified probably benign
R4960:Cp UTSW 3 19973797 missense probably damaging 0.96
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5404:Cp UTSW 3 19989128 missense possibly damaging 0.92
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense probably damaging 1.00
R7136:Cp UTSW 3 19985658 nonsense probably null
R7212:Cp UTSW 3 19974966 missense probably damaging 1.00
R7269:Cp UTSW 3 19983477 missense probably damaging 1.00
R7316:Cp UTSW 3 19972752 missense probably damaging 1.00
R7336:Cp UTSW 3 19964532 splice site probably null
R7361:Cp UTSW 3 19964306 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TAGTTAGAGAAGCCTGGCCACAG -3'
(R):5'- GGTAACATGAATTTGGCCCATAAAG -3'

Sequencing Primer
(F):5'- AACTGTGTTTGTTTTGGTTTTTCCCC -3'
(R):5'- CCCAGACTGCTTCAGTAA -3'
Posted On2016-12-15