Incidental Mutation 'R5790:C6'
ID448299
Institutional Source Beutler Lab
Gene Symbol C6
Ensembl Gene ENSMUSG00000022181
Gene Namecomplement component 6
Synonyms
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4727175-4814967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4763486 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 358 (F358I)
Ref Sequence ENSEMBL: ENSMUSP00000124417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022788] [ENSMUST00000161997] [ENSMUST00000162350] [ENSMUST00000162585]
Predicted Effect probably damaging
Transcript: ENSMUST00000022788
AA Change: F358I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022788
Gene: ENSMUSG00000022181
AA Change: F358I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161997
SMART Domains Protein: ENSMUSP00000125358
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
Blast:TSP1 197 223 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162350
AA Change: F358I

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125693
Gene: ENSMUSG00000022181
AA Change: F358I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Blast:FIMAC 859 931 1e-36 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162585
AA Change: F358I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124417
Gene: ENSMUSG00000022181
AA Change: F358I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162729
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit decreased susceptibility to ischemia reperfusion-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in C6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:C6 APN 15 4759967 missense possibly damaging 0.53
IGL00918:C6 APN 15 4735257 missense possibly damaging 0.90
IGL01615:C6 APN 15 4781896 missense probably benign 0.00
IGL01637:C6 APN 15 4759917 missense possibly damaging 0.69
IGL01662:C6 APN 15 4792754 missense probably damaging 1.00
IGL02293:C6 APN 15 4755303 missense probably benign 0.01
IGL02431:C6 APN 15 4759861 nonsense probably null
IGL02568:C6 APN 15 4791164 nonsense probably null
IGL02688:C6 APN 15 4798320 missense probably benign 0.00
IGL02737:C6 APN 15 4796914 missense probably benign 0.30
R0195:C6 UTSW 15 4763471 missense probably benign 0.01
R0334:C6 UTSW 15 4755367 missense probably benign 0.24
R0879:C6 UTSW 15 4763336 splice site probably benign
R0940:C6 UTSW 15 4735235 missense probably benign 0.12
R1342:C6 UTSW 15 4739749 splice site probably benign
R1649:C6 UTSW 15 4735257 missense possibly damaging 0.90
R1709:C6 UTSW 15 4790970 missense probably benign 0.34
R1967:C6 UTSW 15 4759820 missense probably damaging 0.99
R2068:C6 UTSW 15 4791070 missense probably damaging 1.00
R3056:C6 UTSW 15 4739873 missense probably damaging 0.99
R3791:C6 UTSW 15 4735235 missense probably benign 0.00
R3821:C6 UTSW 15 4789584 missense probably benign 0.23
R3895:C6 UTSW 15 4808470 missense probably benign 0.00
R4178:C6 UTSW 15 4735139 missense probably benign 0.02
R4440:C6 UTSW 15 4735251 missense possibly damaging 0.90
R4598:C6 UTSW 15 4763370 missense possibly damaging 0.55
R4632:C6 UTSW 15 4759868 missense probably benign 0.01
R4756:C6 UTSW 15 4781912 missense probably benign
R4879:C6 UTSW 15 4803647 unclassified probably null
R5452:C6 UTSW 15 4814829 missense possibly damaging 0.51
R5538:C6 UTSW 15 4814829 missense possibly damaging 0.84
R5547:C6 UTSW 15 4808488 missense probably benign 0.00
R5862:C6 UTSW 15 4735263 missense possibly damaging 0.66
R5946:C6 UTSW 15 4808514 missense possibly damaging 0.96
R6049:C6 UTSW 15 4735172 missense probably damaging 1.00
R6247:C6 UTSW 15 4763541 missense probably damaging 1.00
R6438:C6 UTSW 15 4796983 missense possibly damaging 0.94
R6873:C6 UTSW 15 4790979 missense probably benign 0.03
R7052:C6 UTSW 15 4733695 missense probably damaging 0.97
R7302:C6 UTSW 15 4796950 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGAAGACTGCATGTATGG -3'
(R):5'- GCACTTTTGGGATAGCATTGGAAATG -3'

Sequencing Primer
(F):5'- CTGCAGTAGGAATGGGGCTAATG -3'
(R):5'- TGGGATAGCATTGGAAATGTAATTG -3'
Posted On2016-12-15