Incidental Mutation 'R5790:Asap1'
ID448304
Institutional Source Beutler Lab
Gene Symbol Asap1
Ensembl Gene ENSMUSG00000022377
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain1
SynonymsDdef1, mKIAA1249
MMRRC Submission 043384-MU
Accession Numbers

Genbank: NM_010026; MGI: 1342335

Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location64086857-64382919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64094265 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 997 (D997V)
Ref Sequence ENSEMBL: ENSMUSP00000134825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023008] [ENSMUST00000110114] [ENSMUST00000110115] [ENSMUST00000175793] [ENSMUST00000175799] [ENSMUST00000176014] [ENSMUST00000176384] [ENSMUST00000177035] [ENSMUST00000177083] [ENSMUST00000177371] [ENSMUST00000177374]
Predicted Effect probably damaging
Transcript: ENSMUST00000023008
AA Change: D997V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023008
Gene: ENSMUSG00000022377
AA Change: D997V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110114
AA Change: D940V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105741
Gene: ENSMUSG00000022377
AA Change: D940V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110115
AA Change: D982V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105742
Gene: ENSMUSG00000022377
AA Change: D982V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 799 832 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
SH3 1073 1131 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175793
AA Change: D985V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135718
Gene: ENSMUSG00000022377
AA Change: D985V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 328 421 4.12e-15 SMART
ArfGap 442 565 2.18e-34 SMART
ANK 603 635 1.17e-1 SMART
ANK 639 668 3.46e-4 SMART
low complexity region 715 726 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 802 835 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 959 972 N/A INTRINSIC
low complexity region 1053 1065 N/A INTRINSIC
SH3 1076 1134 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175799
AA Change: D937V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135359
Gene: ENSMUSG00000022377
AA Change: D937V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 911 924 N/A INTRINSIC
low complexity region 1005 1017 N/A INTRINSIC
SH3 1028 1086 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176014
AA Change: D994V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135172
Gene: ENSMUSG00000022377
AA Change: D994V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 811 844 N/A INTRINSIC
low complexity region 853 862 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
SH3 1085 1143 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176384
AA Change: D940V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135190
Gene: ENSMUSG00000022377
AA Change: D940V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176909
Predicted Effect probably damaging
Transcript: ENSMUST00000177035
AA Change: D925V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135346
Gene: ENSMUSG00000022377
AA Change: D925V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 899 912 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
SH3 1016 1074 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177083
AA Change: D962V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134877
Gene: ENSMUSG00000022377
AA Change: D962V

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 305 398 4.12e-15 SMART
ArfGap 419 542 2.18e-34 SMART
ANK 580 612 1.17e-1 SMART
ANK 616 645 3.46e-4 SMART
low complexity region 692 703 N/A INTRINSIC
low complexity region 757 768 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 821 830 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
SH3 1053 1111 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177371
AA Change: D974V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135643
Gene: ENSMUSG00000022377
AA Change: D974V

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 317 410 4.12e-15 SMART
ArfGap 431 554 2.18e-34 SMART
ANK 592 624 1.17e-1 SMART
ANK 628 657 3.46e-4 SMART
low complexity region 704 715 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 824 N/A INTRINSIC
low complexity region 833 842 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
SH3 1065 1123 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177374
AA Change: D997V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134825
Gene: ENSMUSG00000022377
AA Change: D997V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:BAR 18 267 1.8e-11 PFAM
Pfam:BAR_3 52 286 1.2e-29 PFAM
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228817
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ADP-ribosylation factor (ARF) GTPase-activating protein. The GTPase-activating activity is stimulated by phosphatidylinositol 4,5-biphosphate (PIP2), and is greater towards ARF1 and ARF5, and lesser for ARF6. This gene maybe involved in regulation of membrane trafficking and cytoskeleton remodeling. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Asap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Asap1 APN 15 64119954 splice site probably benign
IGL00473:Asap1 APN 15 64173215 splice site probably benign
IGL00519:Asap1 APN 15 64110942 missense probably damaging 1.00
IGL01304:Asap1 APN 15 64312449 missense probably damaging 1.00
IGL01510:Asap1 APN 15 64158928 missense probably damaging 1.00
IGL02208:Asap1 APN 15 64122033 missense probably damaging 1.00
IGL02338:Asap1 APN 15 64123670 critical splice donor site probably null
IGL02429:Asap1 APN 15 64167740 missense probably damaging 1.00
IGL02565:Asap1 APN 15 64129165 splice site probably benign
IGL02644:Asap1 APN 15 64111062 missense probably damaging 1.00
IGL02684:Asap1 APN 15 64094169 missense probably benign
IGL02707:Asap1 APN 15 64129274 missense probably damaging 1.00
IGL03052:Asap1 APN 15 64153834 splice site probably benign
IGL03153:Asap1 APN 15 64160274 missense probably damaging 1.00
A4554:Asap1 UTSW 15 64124711 splice site probably benign
PIT4378001:Asap1 UTSW 15 64135848 missense probably damaging 0.99
R0081:Asap1 UTSW 15 64099564 missense probably damaging 1.00
R0555:Asap1 UTSW 15 64094364 missense probably damaging 1.00
R1414:Asap1 UTSW 15 64158884 missense possibly damaging 0.92
R1437:Asap1 UTSW 15 64120107 missense probably damaging 0.96
R1474:Asap1 UTSW 15 64120020 missense probably benign 0.01
R1489:Asap1 UTSW 15 64172730 missense probably damaging 1.00
R1553:Asap1 UTSW 15 64152852 missense probably benign 0.31
R1603:Asap1 UTSW 15 64129257 missense probably damaging 1.00
R1636:Asap1 UTSW 15 64123912 missense probably damaging 1.00
R1645:Asap1 UTSW 15 64089475 missense probably damaging 0.99
R1861:Asap1 UTSW 15 64135798 splice site probably benign
R2136:Asap1 UTSW 15 64110959 missense probably damaging 1.00
R2351:Asap1 UTSW 15 64135804 critical splice donor site probably null
R4436:Asap1 UTSW 15 64349843 missense probably benign 0.03
R4618:Asap1 UTSW 15 64152895 missense probably damaging 1.00
R4868:Asap1 UTSW 15 64094181 missense probably benign
R5077:Asap1 UTSW 15 64127423 missense probably damaging 1.00
R5333:Asap1 UTSW 15 64127414 missense possibly damaging 0.79
R5391:Asap1 UTSW 15 64094052 missense possibly damaging 0.57
R5493:Asap1 UTSW 15 64130151 missense possibly damaging 0.85
R5665:Asap1 UTSW 15 64312453 missense probably damaging 1.00
R5756:Asap1 UTSW 15 64167707 missense probably damaging 1.00
R6139:Asap1 UTSW 15 64166539 missense possibly damaging 0.87
R6194:Asap1 UTSW 15 64129209 missense probably damaging 1.00
R6361:Asap1 UTSW 15 64349823 splice site probably null
R6751:Asap1 UTSW 15 64094412 missense possibly damaging 0.86
R7143:Asap1 UTSW 15 64191528 missense probably damaging 1.00
R7218:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7225:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7305:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7310:Asap1 UTSW 15 64099530 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTGCTTCTGGATGGCATC -3'
(R):5'- GAGACCAGCCATCATCTCTC -3'

Sequencing Primer
(F):5'- CATCTCTGGACTGTACATTTGGAGAC -3'
(R):5'- TCCCACCTGAGACTTTTCAGAAATC -3'
Posted On2016-12-15