Incidental Mutation 'R5818:Numb'
ID449182
Institutional Source Beutler Lab
Gene Symbol Numb
Ensembl Gene ENSMUSG00000021224
Gene NameNUMB endocytic adaptor protein
Synonymsm-numb
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5818 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83794034-83921934 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 83825254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021647] [ENSMUST00000021647] [ENSMUST00000085215] [ENSMUST00000110298] [ENSMUST00000117217] [ENSMUST00000126943] [ENSMUST00000129335] [ENSMUST00000135962] [ENSMUST00000135962] [ENSMUST00000136848] [ENSMUST00000154043] [ENSMUST00000155112] [ENSMUST00000155112]
Predicted Effect probably null
Transcript: ENSMUST00000021647
SMART Domains Protein: ENSMUSP00000021647
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 339 4.7e-42 PFAM
low complexity region 413 434 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021647
SMART Domains Protein: ENSMUSP00000021647
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 339 4.7e-42 PFAM
low complexity region 413 434 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085215
SMART Domains Protein: ENSMUSP00000082311
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 322 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110298
SMART Domains Protein: ENSMUSP00000105927
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PID 39 76 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117217
SMART Domains Protein: ENSMUSP00000113591
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 4.5e-42 PFAM
low complexity region 402 423 N/A INTRINSIC
low complexity region 434 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126943
SMART Domains Protein: ENSMUSP00000122960
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PDB:1WJ1|A 21 65 3e-21 PDB
SCOP:d1ddma_ 23 65 6e-6 SMART
Blast:PTB 34 65 1e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000129335
SMART Domains Protein: ENSMUSP00000119303
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 258 338 9.9e-32 PFAM
low complexity region 462 483 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135962
SMART Domains Protein: ENSMUSP00000122977
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PTB 38 147 9.3e-8 PFAM
Pfam:PID 39 148 4.7e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135962
SMART Domains Protein: ENSMUSP00000122977
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PTB 38 147 9.3e-8 PFAM
Pfam:PID 39 148 4.7e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136848
SMART Domains Protein: ENSMUSP00000122597
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PTB 38 112 2.4e-8 PFAM
Pfam:PID 39 113 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154043
SMART Domains Protein: ENSMUSP00000117899
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 5.1e-42 PFAM
low complexity region 451 472 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155112
SMART Domains Protein: ENSMUSP00000116863
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 163 5.63e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155112
SMART Domains Protein: ENSMUSP00000116863
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 163 5.63e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222771
Meta Mutation Damage Score 0.6184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a conserved protein that is distributed asymmetrically during cell division in the developing embryo. The encoded protein participates in cell fate decisions by interacting with the Notch receptor. Loss of function of this gene results in severe defects in neural development and loss of viability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele die at ~E11.5 with neural tube closure defects and precocious cortical neurogenesis. Mice homozygous for another null allele show impaired axial rotation, neural tube closure, angiogenic remodeling, placenta formation, and motor and sensory neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Numb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Numb APN 12 83808132 missense probably damaging 1.00
IGL01979:Numb APN 12 83842277 missense probably damaging 1.00
IGL02318:Numb APN 12 83831918 intron probably null
IGL02716:Numb APN 12 83801208 missense possibly damaging 0.79
IGL03206:Numb APN 12 83825296 splice site probably benign
PIT4468001:Numb UTSW 12 83808147 missense probably damaging 0.99
R0086:Numb UTSW 12 83795930 missense probably damaging 1.00
R0626:Numb UTSW 12 83795840 missense probably damaging 0.97
R0652:Numb UTSW 12 83795792 missense probably damaging 1.00
R1201:Numb UTSW 12 83801285 missense probably damaging 0.99
R1295:Numb UTSW 12 83796161 splice site probably benign
R1433:Numb UTSW 12 83797259 missense probably damaging 0.98
R1489:Numb UTSW 12 83795443 missense probably damaging 1.00
R1606:Numb UTSW 12 83801010 splice site probably null
R1980:Numb UTSW 12 83797344 critical splice acceptor site probably null
R3771:Numb UTSW 12 83799576 missense probably damaging 0.99
R5382:Numb UTSW 12 83808205 missense probably damaging 1.00
R5846:Numb UTSW 12 83876747 utr 5 prime probably benign
R6360:Numb UTSW 12 83797262 missense probably damaging 0.99
R6384:Numb UTSW 12 83803974 missense probably damaging 1.00
R7186:Numb UTSW 12 83796146 missense probably damaging 1.00
R7469:Numb UTSW 12 83803804 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGTTTTCCCAGAAATGAGAGTTAG -3'
(R):5'- CTGTCACTCCTGGTATGGATAACTC -3'

Sequencing Primer
(F):5'- cCCAGGTAATATCATAGACAG -3'
(R):5'- TCTATAAAACTTATCCCCACCCTTC -3'
Posted On2016-12-20