Incidental Mutation 'R5818:Zscan26'
ID449185
Institutional Source Beutler Lab
Gene Symbol Zscan26
Ensembl Gene ENSMUSG00000022228
Gene Namezinc finger and SCAN domain containing 26
SynonymsZfp187
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5818 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21442180-21453730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21445761 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000032820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032820] [ENSMUST00000110485] [ENSMUST00000122872] [ENSMUST00000148071] [ENSMUST00000151743]
Predicted Effect probably benign
Transcript: ENSMUST00000032820
AA Change: S65P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032820
Gene: ENSMUSG00000022228
AA Change: S65P

DomainStartEndE-ValueType
ZnF_C2H2 144 166 1.58e-3 SMART
ZnF_C2H2 172 194 6.99e-5 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 228 250 1.45e-2 SMART
ZnF_C2H2 256 278 2.53e-2 SMART
ZnF_C2H2 284 306 5.14e-3 SMART
ZnF_C2H2 312 334 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110485
AA Change: S191P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106111
Gene: ENSMUSG00000022228
AA Change: S191P

DomainStartEndE-ValueType
SCAN 38 151 1.58e-48 SMART
ZnF_C2H2 270 292 1.58e-3 SMART
ZnF_C2H2 298 320 6.99e-5 SMART
ZnF_C2H2 326 348 1.67e-2 SMART
ZnF_C2H2 354 376 1.45e-2 SMART
ZnF_C2H2 382 404 2.53e-2 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 2.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122641
Predicted Effect probably benign
Transcript: ENSMUST00000122872
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122926
Predicted Effect probably benign
Transcript: ENSMUST00000148071
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151743
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Other mutations in Zscan26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Zscan26 APN 13 21445101 missense probably damaging 0.99
IGL00720:Zscan26 APN 13 21445199 missense probably benign 0.00
R0558:Zscan26 UTSW 13 21445055 missense probably benign 0.37
R1236:Zscan26 UTSW 13 21445770 missense probably benign
R1912:Zscan26 UTSW 13 21445140 missense possibly damaging 0.84
R4692:Zscan26 UTSW 13 21445257 missense probably damaging 1.00
R6089:Zscan26 UTSW 13 21448329 missense probably damaging 0.97
Z1088:Zscan26 UTSW 13 21445463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATTCCCAGGACATTTCTCC -3'
(R):5'- AGGTTAGGCCATGTTATTCTGC -3'

Sequencing Primer
(F):5'- AGGACATTTCTCCTGTATGTGC -3'
(R):5'- GTAACTCCAGTTTCCGGGAACTG -3'
Posted On2016-12-20