Incidental Mutation 'R5827:Nr1d2'
ID450229
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Namenuclear receptor subfamily 1, group D, member 2
SynonymsRev-erb beta, RVR
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location18204054-18239127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18222248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 8 (V8L)
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543] [ENSMUST00000225491]
PDB Structure
[]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090543
AA Change: V8L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775
AA Change: V8L

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143308
Predicted Effect probably benign
Transcript: ENSMUST00000225491
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18215502 intron probably benign
IGL00897:Nr1d2 APN 14 18214993 missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18222011 missense probably benign
IGL03039:Nr1d2 APN 14 18215184 missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18216703 missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18215403 missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18215502 intron probably benign
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18215086 missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18211891 missense probably benign 0.04
R3115:Nr1d2 UTSW 14 18215504 splice site probably null
R3738:Nr1d2 UTSW 14 18211804 missense possibly damaging 0.74
R4165:Nr1d2 UTSW 14 18215446 missense probably benign 0.05
R5319:Nr1d2 UTSW 14 18215197 missense probably benign 0.00
R5353:Nr1d2 UTSW 14 18222125 missense probably benign 0.05
R5384:Nr1d2 UTSW 14 18211922 missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18206860 missense possibly damaging 0.65
X0067:Nr1d2 UTSW 14 18211823 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGGACAATCTGTGCGGTCAC -3'
(R):5'- AGGTCTGTGTGTTCTTATGACAGAC -3'

Sequencing Primer
(F):5'- GTGCGGTCACTCTTCAGAACAC -3'
(R):5'- ACTTTGTAGAGGGAGTAATATGACAC -3'
Posted On2016-12-20