Incidental Mutation 'R5713:Slc26a8'
ID451020
Institutional Source Beutler Lab
Gene Symbol Slc26a8
Ensembl Gene ENSMUSG00000036196
Gene Namesolute carrier family 26, member 8
Synonyms
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R5713 (G1)
Quality Score191
Status Validated
Chromosome17
Chromosomal Location28637783-28689987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28661879 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 308 (M308L)
Ref Sequence ENSEMBL: ENSMUSP00000110412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114764]
Predicted Effect probably benign
Transcript: ENSMUST00000114764
AA Change: M308L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110412
Gene: ENSMUSG00000036196
AA Change: M308L

DomainStartEndE-ValueType
Pfam:Sulfate_transp 90 491 1.2e-72 PFAM
low complexity region 494 509 N/A INTRINSIC
Pfam:STAS 542 792 7.3e-16 PFAM
low complexity region 881 896 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145224
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26 gene family of anion transporters. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. The expression of this gene appears to be restricted to spermatocytes. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit male sterility associated with sperm immotility, abnormal flagella and reduced acrosomal reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Slc26a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc26a8 APN 17 28654948 missense probably benign 0.01
IGL02041:Slc26a8 APN 17 28642251 missense probably damaging 1.00
IGL02389:Slc26a8 APN 17 28638650 missense probably benign 0.00
E0370:Slc26a8 UTSW 17 28642387 missense possibly damaging 0.77
FR4449:Slc26a8 UTSW 17 28638316 small deletion probably benign
R1028:Slc26a8 UTSW 17 28672798 missense probably damaging 1.00
R1445:Slc26a8 UTSW 17 28648213 missense possibly damaging 0.72
R1501:Slc26a8 UTSW 17 28638562 missense possibly damaging 0.73
R1606:Slc26a8 UTSW 17 28638481 missense possibly damaging 0.73
R1819:Slc26a8 UTSW 17 28684834 missense probably benign 0.31
R1950:Slc26a8 UTSW 17 28644640 missense probably benign 0.06
R1973:Slc26a8 UTSW 17 28663605 missense probably benign 0.01
R2203:Slc26a8 UTSW 17 28648007 missense probably benign 0.06
R3912:Slc26a8 UTSW 17 28644779 missense possibly damaging 0.92
R4176:Slc26a8 UTSW 17 28647999 missense probably benign 0.04
R4539:Slc26a8 UTSW 17 28659617 missense probably benign 0.00
R4661:Slc26a8 UTSW 17 28638684 missense probably benign 0.04
R4766:Slc26a8 UTSW 17 28638661 missense probably benign 0.01
R4850:Slc26a8 UTSW 17 28654883 missense probably benign 0.01
R4867:Slc26a8 UTSW 17 28663634 missense probably benign 0.05
R5521:Slc26a8 UTSW 17 28654859 missense probably benign 0.10
R6092:Slc26a8 UTSW 17 28648155 missense probably damaging 1.00
R6135:Slc26a8 UTSW 17 28669940 missense probably benign 0.00
R6372:Slc26a8 UTSW 17 28644803 missense probably benign 0.08
R6543:Slc26a8 UTSW 17 28638401 missense possibly damaging 0.53
R6590:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6690:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6866:Slc26a8 UTSW 17 28638481 missense probably benign 0.27
R7057:Slc26a8 UTSW 17 28638397 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCAGTTTTGATCTGATTCACTGTTT -3'
(R):5'- TCCCTAAGGAAGCCTCTGCA -3'

Sequencing Primer
(F):5'- TTATGAGCCTCCAAGGTAGGTCC -3'
(R):5'- CCTAAGGAAGCCTCTGCAATATTTTC -3'
Posted On2017-01-03